ID: 1137268084

View in Genome Browser
Species Human (GRCh38)
Location 16:46884831-46884853
Sequence GCGCTCGCGCCGGCTGCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137268084_1137268092 20 Left 1137268084 16:46884831-46884853 CCGAGCGCAGCCGGCGCGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 99
Right 1137268092 16:46884874-46884896 GAACCCGCAGGTGAAGGCGGTGG 0: 1
1: 0
2: 1
3: 8
4: 177
1137268084_1137268086 -10 Left 1137268084 16:46884831-46884853 CCGAGCGCAGCCGGCGCGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 99
Right 1137268086 16:46884844-46884866 GCGCGAGCGCATCCTCACGCTGG 0: 1
1: 0
2: 0
3: 3
4: 37
1137268084_1137268091 17 Left 1137268084 16:46884831-46884853 CCGAGCGCAGCCGGCGCGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 99
Right 1137268091 16:46884871-46884893 CATGAACCCGCAGGTGAAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 157
1137268084_1137268089 14 Left 1137268084 16:46884831-46884853 CCGAGCGCAGCCGGCGCGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 99
Right 1137268089 16:46884868-46884890 GTCCATGAACCCGCAGGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 74
1137268084_1137268088 8 Left 1137268084 16:46884831-46884853 CCGAGCGCAGCCGGCGCGAGCGC 0: 1
1: 0
2: 2
3: 10
4: 99
Right 1137268088 16:46884862-46884884 GCTGGAGTCCATGAACCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137268084 Original CRISPR GCGCTCGCGCCGGCTGCGCT CGG (reversed) Exonic
901836262 1:11926001-11926023 GCGCTCCCGCAGGCCGCGCCAGG + Exonic
901930731 1:12595178-12595200 GGGCTCACCCCCGCTGCGCTAGG - Intronic
903652369 1:24929917-24929939 GCGCCCGCGCCGGCCGCCCCCGG - Intronic
906048459 1:42851332-42851354 CCGCTCGTGCCGGATGCGGTTGG - Exonic
908796048 1:67832795-67832817 GCGCTCCCGCCGGCTGGTCCCGG + Intronic
912492084 1:110068024-110068046 ACTCTCGCGCCGTCCGCGCTTGG - Intronic
914813621 1:151047684-151047706 GCGCTCGCGCGGGCCGCGCGGGG - Intergenic
922505085 1:226121650-226121672 GCGCTCCCGCCTGCTGCGCGCGG - Intergenic
1063202248 10:3794879-3794901 GCTCTCGGGCCAGATGCGCTTGG + Intergenic
1072169788 10:92848412-92848434 GCGCTCGGGCCGGCGGCGCGGGG - Intronic
1073465612 10:103693128-103693150 GCCCTCGGGCTGGCTGCGGTCGG + Intronic
1075519955 10:123137234-123137256 ACGCTCGCCCCGGCCGCGCCTGG - Exonic
1077919152 11:6630356-6630378 GCGCTACCGCCTGCTGCGCCAGG - Exonic
1078729566 11:13963053-13963075 GCCCTCGCGCCGCGTGCCCTGGG - Exonic
1079090448 11:17476781-17476803 GCGCGGGCGCGGGCTGGGCTCGG + Exonic
1081845533 11:46238141-46238163 CTGCTCGCGCGGGGTGCGCTCGG - Intergenic
1082076759 11:47980948-47980970 GCGCTCGCCCGGGCTGCGCTGGG + Exonic
1084010856 11:66347631-66347653 CGGCTCGCCTCGGCTGCGCTCGG - Exonic
1086993391 11:93330458-93330480 GCGCTCGCGCGGGGTGAGGTTGG + Intronic
1090854344 11:130598654-130598676 GCGCATGCGCAGGATGCGCTTGG + Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092256205 12:6927987-6928009 GCGCGGGTGCGGGCTGCGCTAGG + Intronic
1092365504 12:7873301-7873323 GCGGGCGGGCCGGCTGGGCTGGG + Intronic
1092508567 12:9128577-9128599 GCGCTCGAGCAGGATGCGGTCGG - Intergenic
1097281251 12:57846478-57846500 GCGGGCGCGCGGGCTGGGCTGGG + Exonic
1104568226 12:129903743-129903765 GCGCTGGCGCAGGCGGCGCCGGG + Intergenic
1110558413 13:76885804-76885826 GCGCTGCAGCCGGCTGCGCTCGG + Exonic
1112504710 13:99968921-99968943 ACGCTCGGGCCGGGGGCGCTCGG - Intronic
1113520424 13:110936682-110936704 GCGCTTCCGCCGCCTGCGCCTGG - Intergenic
1113780410 13:112973629-112973651 GTGCTCGCGCCGTCTTCGCATGG - Intronic
1113874172 13:113584450-113584472 GCGCGCGCGCGGCGTGCGCTCGG - Intergenic
1115816750 14:37172045-37172067 GCGTCCGCGCCGGCCGCTCTCGG - Intronic
1117131955 14:52695678-52695700 GCGCCCGCGCCGGCAGCCCGGGG + Exonic
1128733022 15:70033726-70033748 TCACTCGCTCCGGCTGCGCCTGG + Intergenic
1132370615 15:101295273-101295295 GCGCACTCGGCGGCTGCGATTGG - Intronic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1132519931 16:382203-382225 GAGGTCGCGCCGGGCGCGCTCGG + Intronic
1134531897 16:14989924-14989946 GCGCTCCCGCAGGCCGCGCCAGG + Intronic
1135517667 16:23149154-23149176 GCGCTGGCGGCGGCGGCGCGGGG - Exonic
1137268084 16:46884831-46884853 GCGCTCGCGCCGGCTGCGCTCGG - Exonic
1138229078 16:55324638-55324660 GCGCACGGGCTGGCTGCGCTTGG + Exonic
1140509248 16:75495378-75495400 GCGCTCGGGCGGGCTGCACCGGG - Intronic
1143596189 17:7915730-7915752 GCGCGCGCTCCGGCGGCTCTGGG - Intergenic
1144851258 17:18245215-18245237 GCGGCCGCGCCGGCTGCGCCTGG - Exonic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146283641 17:31560194-31560216 GCGCTCGCCCCGGCTGCGTGCGG + Intergenic
1146753737 17:35407717-35407739 GTGCTGGCGACGGCTGCCCTGGG - Intergenic
1147559920 17:41502385-41502407 GCCCTCGAGCAGGCTGCGGTAGG + Exonic
1147996768 17:44363855-44363877 GCGCTTGCGGCGGCTCCGGTCGG - Exonic
1152049266 17:77959342-77959364 GCGCCCGCCCCGGCTCGGCTCGG - Intergenic
1152092446 17:78254472-78254494 TCGCTCTCGCCGCCTTCGCTGGG - Intergenic
1153688231 18:7567338-7567360 GAGCCCGCGCCGGCTGCGCGCGG - Exonic
1153886883 18:9475388-9475410 GCTCTCGCGCGGGGCGCGCTGGG - Intronic
1161080626 19:2308245-2308267 GGGCGCGCGGGGGCTGCGCTGGG + Intronic
1162022826 19:7875550-7875572 CCACTCGCTCCGGCTGGGCTGGG - Intergenic
1162238156 19:9324416-9324438 GGGGTCGAGGCGGCTGCGCTGGG + Intronic
1163145829 19:15379081-15379103 ACTCTCGCGCCGGCAGCACTCGG + Intronic
1163806911 19:19405350-19405372 GACCTCGCGCCAGCTGAGCTGGG - Intronic
1166107030 19:40602510-40602532 GAGCTCACGCCGGCCGGGCTGGG - Intronic
1167080794 19:47274988-47275010 GCGGGGGCGCTGGCTGCGCTTGG + Exonic
1168506859 19:56942933-56942955 GCGCTCGCGCCGTCTGAGTAGGG - Intergenic
1168506866 19:56942962-56942984 GCGCTCGCGCCGTCTGAGTAGGG - Intergenic
926908869 2:17830670-17830692 GCGCTCCCGCAGTCCGCGCTTGG + Intergenic
934754733 2:96817025-96817047 GCGCTGGCGCCGCGAGCGCTCGG + Exonic
934993280 2:98936195-98936217 GCAGGCGCGCCGGCTTCGCTCGG + Exonic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
941029393 2:160493770-160493792 GCGGCAGCGGCGGCTGCGCTTGG + Exonic
949032494 2:241803677-241803699 GCTGCGGCGCCGGCTGCGCTGGG + Exonic
1170557981 20:17530997-17531019 GCGCTCCAGCCGGGCGCGCTCGG + Exonic
1175429197 20:58890644-58890666 GCGCCCGCGGCCTCTGCGCTTGG - Intronic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1179833527 21:44012777-44012799 GCCCTCGGGCCGGCTGCAGTTGG + Intronic
949709946 3:6861467-6861489 GCGCTGGCGGCGGCGGCGCGCGG + Exonic
950438460 3:12994090-12994112 GCGCTCTCGGCGGCTGCGGGCGG - Intronic
953705148 3:45225519-45225541 GCGGTGGCGGCGGCGGCGCTGGG + Exonic
954028625 3:47802859-47802881 GGGTTGGCGCCGGCTGCTCTGGG - Intergenic
954137395 3:48588330-48588352 GCACTCGCTGAGGCTGCGCTGGG - Exonic
954177582 3:48856732-48856754 GCCCTAGCCCCGGCTGCTCTAGG - Intergenic
960669135 3:120140138-120140160 GCGCCCACTCTGGCTGCGCTTGG + Intergenic
960955432 3:123027625-123027647 GGGCCCGCGCCCGCTGCGCTCGG + Intronic
966595157 3:181719431-181719453 GGCCTCCCGCCGGCTGCCCTGGG + Intergenic
967694518 3:192515238-192515260 GCGGTCCCGCGGGCTGCGCGCGG + Intronic
968655501 4:1776831-1776853 GCGCTCGTCCAGGCTGGGCTGGG + Intergenic
968817928 4:2831389-2831411 GGGCTCGTGCCGACTGCCCTGGG - Intronic
969413337 4:7043416-7043438 GCTCTGGCGGCGGCTGGGCTGGG + Exonic
981504094 4:145481675-145481697 GCGCTCACGCCGGCCGGGCCGGG + Intronic
983904322 4:173168786-173168808 GCGGTGGCGGCGGCTGCGCCGGG + Exonic
983904668 4:173169918-173169940 GAGCTCGCGGCGGCTCCGCTGGG + Intronic
985068410 4:186144891-186144913 GCGCCCGGGCCGCCTGAGCTGGG + Exonic
988990165 5:36662661-36662683 GGGCTCGCGCCGGCAGCTGTGGG + Intronic
992627359 5:78648185-78648207 GGGCTCGCGCCGGCTTCCCGAGG + Intronic
1002559479 5:180071794-180071816 GCGCGCGCGCGGCCTGCGCGGGG + Exonic
1002580949 5:180209165-180209187 GCGCTCGTGCGGGCTGCGCTGGG - Intergenic
1002645257 5:180649605-180649627 GCGCGGGCGCCGGCTGGCCTGGG + Exonic
1004720594 6:18264710-18264732 GGGCTCTCCCCGGCTGCGCCTGG + Exonic
1010057774 6:71585841-71585863 GCCCTCGAGCAGGCTGCGGTAGG - Intergenic
1012237603 6:96837174-96837196 GCGCTTGCATCCGCTGCGCTGGG - Intronic
1013033688 6:106360602-106360624 GCGCTCGCGCCGGGAGCCCCAGG - Intergenic
1019562581 7:1665929-1665951 TGGCTCCCGCCGGCTCCGCTGGG + Intergenic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1025089695 7:56051890-56051912 CCGCCAGCGCCGCCTGCGCTCGG - Exonic
1027421172 7:78019537-78019559 GCCTTCGCGCCGGCAGAGCTCGG + Exonic
1029640735 7:101817343-101817365 GAGCGCGCGGCGGGTGCGCTCGG + Intronic
1035162246 7:156959693-156959715 GCACTCTGGCCGGCTGCTCTGGG + Intronic
1039936524 8:42051459-42051481 GCGCGCGTGCCGGCTGTGCCGGG - Intronic
1044719727 8:95133881-95133903 TGGATCGCGCCGGCTGCGCGGGG + Exonic
1049202505 8:141347184-141347206 GGGCTCGCCCAGGCTGGGCTGGG + Intergenic
1049460983 8:142727703-142727725 GCGCACCCGCCTGCTGGGCTGGG + Exonic
1060968493 9:127724680-127724702 GGGCTGGAGCCGGCTGGGCTGGG + Intronic
1061541057 9:131277976-131277998 CTGCGTGCGCCGGCTGCGCTCGG - Intergenic
1196791617 X:119469228-119469250 GGGCTGGCGGCGGCGGCGCTCGG + Intronic
1199772742 X:150984408-150984430 CCGCCCGCGCCGGCCGCGCGCGG + Intronic