ID: 1137268237

View in Genome Browser
Species Human (GRCh38)
Location 16:46885559-46885581
Sequence TCTGGGGACAGTCACCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137268222_1137268237 26 Left 1137268222 16:46885510-46885532 CCTTCCTTTAGGCCCCTCTGGAG 0: 1
1: 0
2: 0
3: 23
4: 187
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268223_1137268237 22 Left 1137268223 16:46885514-46885536 CCTTTAGGCCCCTCTGGAGCCTT 0: 1
1: 0
2: 0
3: 14
4: 123
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268230_1137268237 -3 Left 1137268230 16:46885539-46885561 CCGACCAGCCACTTCTGTGGTCT 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268227_1137268237 12 Left 1137268227 16:46885524-46885546 CCTCTGGAGCCTTGGCCGACCAG 0: 1
1: 0
2: 1
3: 13
4: 149
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268228_1137268237 3 Left 1137268228 16:46885533-46885555 CCTTGGCCGACCAGCCACTTCTG 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268233_1137268237 -7 Left 1137268233 16:46885543-46885565 CCAGCCACTTCTGTGGTCTGGGG 0: 1
1: 0
2: 3
3: 22
4: 247
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268225_1137268237 14 Left 1137268225 16:46885522-46885544 CCCCTCTGGAGCCTTGGCCGACC 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150
1137268226_1137268237 13 Left 1137268226 16:46885523-46885545 CCCTCTGGAGCCTTGGCCGACCA 0: 1
1: 0
2: 1
3: 10
4: 87
Right 1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137268237 Original CRISPR TCTGGGGACAGTCACCGAGG TGG Intronic
902799416 1:18819999-18820021 CCTGTGGTCAGTCAGCGAGGAGG - Intergenic
902894501 1:19469588-19469610 TCTGGGGACAGGCAGTGAGGCGG + Intronic
903228066 1:21904921-21904943 TCTGTGGGCAGTGACCCAGGAGG - Intronic
903378330 1:22880216-22880238 TCTAGGGACAGACACAGAGCAGG + Intronic
908789492 1:67767355-67767377 CCTGGAGACAGATACCGAGGTGG + Intronic
912309284 1:108603337-108603359 TCTGGGGACAACCAAAGAGGAGG + Intronic
913178850 1:116299721-116299743 TCTGGGGAAAGTCAGCCTGGAGG - Intergenic
915875673 1:159609728-159609750 TCTGGGGACTGTTACGGAGTGGG + Intergenic
1069651362 10:70052473-70052495 TCTGGGGAGAGTCTTCGAAGGGG - Intergenic
1069892849 10:71662693-71662715 TCTGGGGCCAGTTATCGAGTTGG - Intronic
1070814966 10:79317265-79317287 TCTGTGGACAGTCCCTGTGGAGG - Intergenic
1072662251 10:97370274-97370296 TCTGGGGACAGAGACCAACGTGG + Exonic
1075463085 10:122631733-122631755 CCTGGGGACCCTCGCCGAGGGGG + Intronic
1076721622 10:132395824-132395846 GCCGGGGACAGTCCCAGAGGAGG - Intergenic
1076997742 11:307196-307218 TCTGGGAGCCGTCACCCAGGTGG + Intergenic
1077220926 11:1415848-1415870 CCAGGGGACAGTGGCCGAGGAGG - Intronic
1079019630 11:16898805-16898827 TCTGAGGACAGTGAACTAGGGGG - Intronic
1079372861 11:19866779-19866801 TCTGGGAAGTGTCACGGAGGTGG - Intronic
1080602432 11:33832883-33832905 TCTGGGTCCAGTCACTGAGGTGG - Intergenic
1084088444 11:66865438-66865460 GCTGGGAACAGGCACCGAGCAGG + Intronic
1084804856 11:71571677-71571699 TCTCGGGACAGTCAGCGCCGCGG - Intergenic
1084972174 11:72777907-72777929 TCTGGGGACAGGCCCAGAGCAGG + Intronic
1090251144 11:125252752-125252774 TCTGGTGACAGTGACCAGGGTGG - Intronic
1095980713 12:47973106-47973128 GCTGGGGGCAGTCACTCAGGGGG + Exonic
1096231717 12:49900499-49900521 GCTGGGCACACTCACCCAGGTGG - Intronic
1099243557 12:80167163-80167185 CCTGGGAACAGTCACGGAGTTGG + Intergenic
1103621466 12:122189748-122189770 GCAGGGGACAGCCACCGTGGGGG - Intronic
1106400902 13:29428966-29428988 TAGGGGGACAGGCACCGAGGTGG - Intronic
1108404368 13:50084664-50084686 TGTGGGGACAATCAGCTAGGGGG + Intronic
1112319377 13:98393325-98393347 TAAGGGGAAAGTCACAGAGGAGG - Intronic
1113060514 13:106317255-106317277 TCTGGGGACACTCATGTAGGAGG - Intergenic
1113752413 13:112785429-112785451 CCTGTGGGCAGTCACCGAGAGGG - Intronic
1117340239 14:54785893-54785915 TCTGGGGGAAGTCACAGAAGGGG - Intronic
1119189373 14:72669981-72670003 TCTTGGGACTGTCAGTGAGGTGG + Exonic
1119330406 14:73789282-73789304 TCTGGGAACACTCACTGTGGGGG + Intronic
1119411845 14:74436886-74436908 TCTGGGAAAAGACACCAAGGAGG - Intergenic
1119412114 14:74439153-74439175 TCTGGGAAAAGACACCAAGGAGG - Intergenic
1119428503 14:74551122-74551144 GCTGGGGGCAGTGGCCGAGGGGG + Exonic
1119650712 14:76381059-76381081 TCTGGGGACAGTCACAGACATGG + Intronic
1120575573 14:86176459-86176481 TCAGGGGTCAGTCAGAGAGGTGG - Intergenic
1121464130 14:94103303-94103325 TCTGGGGCCAGGCACACAGGAGG - Intronic
1121677471 14:95765645-95765667 CTTGGGGACATTCATCGAGGAGG - Intergenic
1122323062 14:100867007-100867029 CCTGGGGTTAGTCACCCAGGTGG + Intergenic
1122827103 14:104375606-104375628 TCTTGGGACAGTCACCATAGTGG - Intergenic
1123026502 14:105426731-105426753 TGTGGGGACAGCAACGGAGGAGG + Intronic
1124216928 15:27815307-27815329 TCTGGGCACAGGCACCAAGAGGG - Intronic
1136419633 16:30123454-30123476 GGTGAGGACAGTCTCCGAGGCGG - Intronic
1137268237 16:46885559-46885581 TCTGGGGACAGTCACCGAGGTGG + Intronic
1141824378 16:86468663-86468685 TCTGAGCACAGTCACCGTGAGGG + Intergenic
1142646398 17:1316329-1316351 CCTGGGCAAAGTCACCCAGGAGG - Intergenic
1146481762 17:33210670-33210692 TATGGGGGCAGACAACGAGGAGG + Intronic
1153329044 18:3853938-3853960 TCTGAGTAAAGTCACCAAGGAGG - Intronic
1154151381 18:11908871-11908893 TCTGAGCACAGCCACCGCGGCGG + Exonic
1154155937 18:11944126-11944148 GTTGGGGACAGTCAGAGAGGAGG - Intergenic
1155025368 18:21935802-21935824 CCAGGGGACTGTCACAGAGGTGG + Intergenic
1156684397 18:39627292-39627314 GCTGGGGACAGTCAGAGAGGAGG - Intergenic
1157690513 18:49678224-49678246 CCTGGGGACAGCCAGTGAGGCGG - Intergenic
1159780101 18:72651263-72651285 ACTGGGGAGAGACACTGAGGAGG + Intergenic
1160149443 18:76388044-76388066 GCTGCGGACAGTCAGAGAGGAGG + Intronic
1160266356 18:77343070-77343092 TCTGGGGACAGCCCCCGACATGG - Intergenic
1160317158 18:77858845-77858867 TCTGAGGTCAGCCACCAAGGAGG + Intergenic
1161115243 19:2493090-2493112 CCTGGAGACAGACACAGAGGTGG + Intergenic
1161203420 19:3028535-3028557 TCTGGGGACAGTCAGAGCTGGGG - Intronic
1161849240 19:6730384-6730406 TCTGGGGGCAGACAGCGAGGAGG + Exonic
1162326332 19:10001973-10001995 TCCGGGGACAGGGACAGAGGAGG + Intronic
1162944063 19:14031778-14031800 TCTGGGTACAGCGCCCGAGGCGG - Exonic
1167463648 19:49639108-49639130 TCTGGGGGCAGTCATGGAAGGGG + Intronic
1168058422 19:53876737-53876759 TCAGGGGACAGACTCCAAGGAGG - Intergenic
1168137070 19:54359216-54359238 TCTGGGGATAGAAACCCAGGTGG + Intronic
1168161011 19:54509913-54509935 TCTGGGGATAGAAACCCAGGTGG - Intronic
930137567 2:47917696-47917718 TGTGGGGACAGTGAGGGAGGTGG + Intergenic
931015161 2:57969078-57969100 TTTGGGGGCAGTCACAGATGGGG + Intronic
932158284 2:69437804-69437826 TTTGGGGGCAGTCACTGAGCTGG - Intergenic
933065508 2:77789580-77789602 TCTGGGTTCAGGCACCGGGGTGG - Intergenic
936937737 2:117854164-117854186 TCTGGGGCCAGTCACAGCAGGGG + Intergenic
937515739 2:122653476-122653498 TCTGGGGACAGGCAGTGTGGTGG - Intergenic
944524393 2:200603755-200603777 TCTGGGGACAGTAGAAGAGGAGG - Intronic
947715711 2:232337988-232338010 TCTGGGGACAGGAACAGATGGGG - Intronic
947721245 2:232370365-232370387 TCTGGGGACAGGAACAGATGGGG - Intergenic
947734740 2:232448748-232448770 TCTGGGGACAGGAACAGATGGGG - Intergenic
948368094 2:237471734-237471756 CCTGGGGACGTTCACCCAGGAGG - Intergenic
948567176 2:238894519-238894541 GCAGGGGACAGACCCCGAGGTGG - Intronic
1169734338 20:8821866-8821888 TCTGGGGACAGACAAAGAGCTGG - Intronic
1171310658 20:24142290-24142312 TCTGGGGACTGACACCGAGTGGG + Intergenic
1173457488 20:43215298-43215320 TCTGGGGGCAGTCCCAGATGTGG - Intergenic
1174912012 20:54617718-54617740 GCAGGGGACAGACACTGAGGTGG - Intronic
1175770542 20:61620886-61620908 TCTGGGGGCACTCACCAGGGTGG - Intronic
1178296144 21:31412028-31412050 TCTGTTGATAGACACCGAGGTGG - Intronic
1178584043 21:33858195-33858217 GATGGAGTCAGTCACCGAGGTGG + Intronic
1178944709 21:36937167-36937189 GCTGGGGACAGTGACAGGGGAGG - Exonic
1179720301 21:43312809-43312831 TGTGGGGACAGGCACCCAGTAGG + Intergenic
1180799354 22:18624577-18624599 GCTGGGGAAAGTCCCCGTGGGGG + Intergenic
1181222364 22:21370689-21370711 GCTGGGGAAAGTCCCCGTGGGGG - Intergenic
1181638124 22:24183675-24183697 GCTGGGGAAAGTCCCCGTGGGGG - Intronic
1182258414 22:29054616-29054638 TGTGGGGACAGACACCCAGAAGG + Exonic
1183706090 22:39475653-39475675 CATGGGGACAGTCACAGAGCTGG - Intronic
1184057129 22:42060157-42060179 GATGGGGTCAGTCACCGAGCAGG + Exonic
1184298846 22:43543212-43543234 AGTGGTGGCAGTCACCGAGGAGG + Intronic
1184518994 22:44981297-44981319 GCTGGAGACAGTATCCGAGGAGG - Intronic
1184656579 22:45944816-45944838 TCGGAGGACAGTCAGCGCGGGGG - Intronic
1184894015 22:47396691-47396713 AATGGGGACAGTCACAGAGGAGG - Intergenic
951706751 3:25551488-25551510 TATGGTGCCAGTCACTGAGGTGG + Intronic
954638243 3:52083253-52083275 TCTCTGGACAGGCACAGAGGAGG + Intronic
955229816 3:57088860-57088882 CCTGGGTAGAGTCACCCAGGAGG - Intergenic
959486627 3:106934431-106934453 GCTGGAGACAGTCAGAGAGGAGG + Intergenic
969042928 4:4315050-4315072 TCTGGGGATATTCACAGTGGAGG + Intronic
972403122 4:38723521-38723543 ACTGGGGAGAATCACCAAGGAGG + Intergenic
976448297 4:85157159-85157181 TCTGGGTACAGTCAGCAATGTGG + Intergenic
983529377 4:168794002-168794024 GCTGGGGACAGCCAGAGAGGAGG - Intronic
984541265 4:181040206-181040228 TCTGGGGACTGTCATGGAGTGGG - Intergenic
988814394 5:34819441-34819463 GATGGGGACAGTCATGGAGGTGG - Intronic
992503318 5:77362854-77362876 GCCGGGGGCAGTCACAGAGGGGG - Intronic
992569708 5:78042949-78042971 TCTGATGACATTCACCCAGGAGG - Intronic
993044946 5:82856380-82856402 TCTGAGCACAGTCACCCAGAAGG - Intergenic
997226549 5:132213639-132213661 TCTGGGGACAGACGTGGAGGGGG + Intronic
999135426 5:149315812-149315834 TCTTGGGACAGCCTCTGAGGAGG - Exonic
1000073905 5:157767090-157767112 TCTGGGGACAGGCAAGGAGATGG - Intergenic
1001356932 5:171036187-171036209 ACTGGGGAGAGGCACAGAGGTGG - Intronic
1001554365 5:172626058-172626080 CCTGGGGACAGAGACCGAGCAGG - Intergenic
1006121772 6:31811278-31811300 GCTGGGGACACTCACCTGGGTGG - Exonic
1008572381 6:52828527-52828549 TCTTGTGACACTCAACGAGGAGG - Intergenic
1009944239 6:70324261-70324283 TCTGGGAAAAGTCACTGGGGAGG + Intergenic
1013181552 6:107720834-107720856 TCTGGAGACAGCCACCTTGGGGG - Exonic
1013312798 6:108912977-108912999 TGAGTGGACAGTCACTGAGGTGG + Intronic
1013560434 6:111298127-111298149 TCTGAGGACAGTTACAAAGGAGG + Intergenic
1014694214 6:124598609-124598631 CATGGGGAAAGCCACCGAGGAGG + Intronic
1014795550 6:125720065-125720087 TCTGGAAGCAGTCACCGAGATGG - Intergenic
1019419790 7:945694-945716 GCTGTGGGCAGTCTCCGAGGAGG - Intronic
1019525932 7:1480528-1480550 CCCGGGGACTGTCACCCAGGAGG + Intronic
1019579222 7:1751737-1751759 CCTGGGGGCAGCCACAGAGGAGG + Intergenic
1019896008 7:3983878-3983900 TCGGGGGACAGTCGCAGAGAAGG + Intronic
1023249268 7:38239972-38239994 TCTAGGGACAATAACCGATGAGG + Intergenic
1023250914 7:38260036-38260058 TCTAGGGACAATAACCGATGAGG + Intergenic
1024211648 7:47211190-47211212 TCTGAGGACAGCCACCTATGAGG - Intergenic
1027745038 7:82062291-82062313 TCTGGGGACATTTATGGAGGAGG - Intronic
1029532404 7:101134111-101134133 TCTGGGGATAGTCAATGTGGGGG - Intronic
1031105805 7:117541282-117541304 TCTGGGGAGAGTCACTGAATGGG + Intronic
1032240633 7:130156155-130156177 TCTGGGGACGGTCACTGCTGCGG - Intergenic
1034086246 7:148325459-148325481 TCTGGAGACATTCTCCTAGGAGG - Intronic
1034474581 7:151275190-151275212 TCCGGGCCCAGGCACCGAGGGGG - Intronic
1034565943 7:151915866-151915888 TCTGGGGAGATGCACAGAGGTGG - Intergenic
1035679307 8:1476587-1476609 TCTGAGGAATGTCACCGATGGGG - Intergenic
1035739333 8:1914358-1914380 TCTGGACACAGTGACCGATGTGG + Intronic
1036501177 8:9315551-9315573 TCTGGGGAGATCCATCGAGGGGG + Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1042215725 8:66428720-66428742 TCCGGGGACAGTCTCGCAGGCGG - Intergenic
1047507873 8:125494273-125494295 TGAGGAGACAGTCACAGAGGTGG - Intergenic
1047793214 8:128226745-128226767 ACTGGGGAGAATCACCGACGTGG - Intergenic
1047872604 8:129101560-129101582 CCTGGGGAAAGGCAGCGAGGTGG - Intergenic
1048731125 8:137442057-137442079 TCTGGGGATGGTCAGAGAGGAGG - Intergenic
1054805693 9:69394037-69394059 TGGGGGGACAGTCACAGAGATGG + Intergenic
1057638502 9:96795000-96795022 TCTGTGGACATTCACAGAAGTGG + Intergenic
1060088207 9:120720603-120720625 TCTGGGGACAGGCACTGGGTGGG - Intergenic
1060224565 9:121783134-121783156 TCTGGGGACAGGTTCAGAGGGGG - Intronic
1062133907 9:134914729-134914751 CCAGGGGACAGACAGCGAGGAGG - Intronic
1186301760 X:8206938-8206960 TCTGGGGACAGTGGCAGAAGAGG + Intergenic
1191880951 X:65843408-65843430 TCTGGGGACATACACAGAGGTGG - Intergenic
1199241708 X:145554766-145554788 TCTGGGTCCAGTCACCCAGTGGG - Intergenic
1200060689 X:153482472-153482494 TCCGGGGGCAGGGACCGAGGGGG + Intronic
1200176798 X:154122681-154122703 TCCGGGCACAGTCACAGGGGAGG + Intergenic