ID: 1137269793

View in Genome Browser
Species Human (GRCh38)
Location 16:46895722-46895744
Sequence GCAACTTGAAAGTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137269787_1137269793 24 Left 1137269787 16:46895675-46895697 CCACCATGCCTGGCTAATTTTAA 0: 189
1: 3619
2: 47029
3: 114860
4: 196988
Right 1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 158
1137269789_1137269793 16 Left 1137269789 16:46895683-46895705 CCTGGCTAATTTTAATTTTTTGT 0: 9
1: 195
2: 1373
3: 14409
4: 53021
Right 1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 158
1137269788_1137269793 21 Left 1137269788 16:46895678-46895700 CCATGCCTGGCTAATTTTAATTT 0: 29
1: 519
2: 6659
3: 46733
4: 109864
Right 1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG 0: 1
1: 0
2: 3
3: 26
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137269793 Original CRISPR GCAACTTGAAAGTGTTGCCC AGG Intronic
902413137 1:16223674-16223696 GTAACTTTAAAGAGTGGCCCTGG - Intergenic
907033891 1:51199267-51199289 GGAAATTAAAAGTGTTGGCCAGG - Intergenic
907098011 1:51799570-51799592 CCTACTTGACAGTTTTGCCCTGG - Intronic
910807705 1:91205065-91205087 GCAACTTGGAAGTGTGTCCTGGG + Intergenic
910810687 1:91232662-91232684 GGAACTTGGAAGTGTGTCCCAGG + Intergenic
913174858 1:116264001-116264023 GCAACTCGAAAGTGTGTCCCGGG - Intergenic
915249920 1:154580607-154580629 TCCACTTAAAAGTGTTGGCCAGG + Intergenic
915720106 1:157978656-157978678 GCACATTGAGAGTGTGGCCCTGG - Intergenic
916489734 1:165291141-165291163 GCAAATTGAAACTGTTGCTAAGG - Intronic
916514770 1:165505749-165505771 GCAACTTCATTCTGTTGCCCAGG - Intergenic
922339812 1:224646336-224646358 GCAACTTGGAATTGTGTCCCGGG - Intronic
922577530 1:226672512-226672534 GCAACTTGGAAGTGTGTCCTGGG + Intronic
1063746651 10:8891239-8891261 GCAACTTCTGAGTGTTGCCATGG + Intergenic
1064567449 10:16656333-16656355 GCAACTTGAAATGGCTGCCTAGG + Intronic
1065992017 10:31020287-31020309 GCAACTTGGAAGTGTGTCCCTGG - Intronic
1068302618 10:55163760-55163782 GCAACTTCCAAATGTTGCCATGG - Intronic
1068817991 10:61339321-61339343 GCCACGTGAAAGTGTGGGCCAGG + Intergenic
1069461770 10:68602009-68602031 GTAACTTGAAAATGTTGACACGG + Intronic
1069994755 10:72335485-72335507 GGAACTTGAAACTGTTGCTGAGG - Exonic
1070552017 10:77497381-77497403 TGAACTTGAAAGTGATGCACTGG + Intronic
1072904520 10:99440432-99440454 GGAACTTGGAAGTGTTGTCATGG - Intergenic
1075809787 10:125216700-125216722 GCAATTGGAAACTGTTGACCAGG + Intergenic
1079343516 11:19632421-19632443 GCAAACTGAAAGTGTTGTCTAGG + Intronic
1082819612 11:57536056-57536078 GGAACTTGGAGGTCTTGCCCGGG - Intergenic
1084582445 11:70032405-70032427 GCTACTTGAAAAGGCTGCCCTGG - Intergenic
1085482384 11:76833409-76833431 GCAACTTGGAAGTGTGTCCTGGG - Intergenic
1086570879 11:88283030-88283052 GCAATTTGGAAGTGTTTCCTGGG - Intergenic
1088419456 11:109626589-109626611 GCCACTTGAAATTGTTTCACAGG - Intergenic
1088817408 11:113431203-113431225 GCTACTTGACAGTGTTTCCTGGG + Intronic
1089544534 11:119213004-119213026 GAATCTTGACAGTGTTGCCCAGG + Intronic
1091611674 12:2015599-2015621 GCAATTTTAAAGTGTGGCCAGGG - Intronic
1091968681 12:4767124-4767146 CCAACTACAAAGTGTTCCCCTGG + Intronic
1093523080 12:20073080-20073102 GCAACTTGGAAGTGTGTCCCTGG - Intergenic
1094747852 12:33367016-33367038 GAAACTAGAAAGTTTTGGCCAGG + Intergenic
1096017743 12:48293947-48293969 TCTACTTGAATTTGTTGCCCTGG + Intergenic
1097278893 12:57832250-57832272 GGAGCTTGAAAGTGATGTCCAGG - Intronic
1099122097 12:78703495-78703517 GGAATTTCAACGTGTTGCCCAGG + Intergenic
1100810533 12:98333022-98333044 GCAACTTGGAAGTATTTCCCAGG + Intergenic
1101374951 12:104163589-104163611 GTAATTTGGAAGTGTTTCCCAGG - Intergenic
1102742849 12:115223399-115223421 GCATCTTCAAAGGGATGCCCTGG - Intergenic
1105637793 13:22232155-22232177 GCTATTTGACAGTGTTGCACAGG - Intergenic
1105698753 13:22917130-22917152 GTGACTTGAGAGTGTTGCTCTGG + Intergenic
1105850451 13:24329677-24329699 GTGACTTGAGAGTGTTGCTCTGG + Intergenic
1107837481 13:44423407-44423429 GCTACTTGCAGGTGTGGCCCTGG - Intergenic
1108127248 13:47257742-47257764 GCAACTTGAAAGTCAGTCCCTGG + Intergenic
1108252153 13:48578145-48578167 ACAACTTGGAAGTGTTTCCCGGG - Intergenic
1110848395 13:80216387-80216409 GCAACTTGAAAATCTTGGCTGGG - Intergenic
1112608436 13:100931027-100931049 GCAACTTAGAAGTATTTCCCGGG - Intergenic
1118234878 14:63993142-63993164 TCAACTTCAAAGTTTTGCCCAGG - Intronic
1119276025 14:73357105-73357127 GTAACTAAAAAGTGTTGGCCGGG + Intronic
1122274684 14:100585511-100585533 GCTCCTTCAAAGTGTTGCCGTGG + Intronic
1122465321 14:101929629-101929651 GCAACTTGGAAGTGTTTCCTAGG - Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1126141108 15:45439536-45439558 GCAACTGGGAAGTGTGTCCCGGG - Intronic
1129905546 15:79184773-79184795 GCAGCTTGAAAATATTCCCCTGG + Intergenic
1130608427 15:85338524-85338546 GCATTTTTAAAGTGTTGACCAGG - Intergenic
1130744775 15:86639375-86639397 GCAACTCCAAAGTGTTACTCTGG + Intronic
1135288623 16:21215616-21215638 GCAACTTGGAAGTGTTTCCTGGG - Intergenic
1136183043 16:28567916-28567938 GCAACTTACAAGTGTGTCCCAGG - Intronic
1137269793 16:46895722-46895744 GCAACTTGAAAGTGTTGCCCAGG + Intronic
1137976527 16:53036892-53036914 CCAAGTTGAAAGTGTTTCCCGGG + Intergenic
1139945782 16:70640974-70640996 GAGAATTGAAAGTGTTGCCTGGG + Intronic
1140058717 16:71548656-71548678 GCAACTTCCAGGTGTTGCCATGG - Intronic
1141098461 16:81179702-81179724 GCAACGTGGAGGTGTTGCTCTGG + Intergenic
1141745172 16:85920652-85920674 GCATATTGAAGGTCTTGCCCAGG - Intronic
1143467071 17:7144384-7144406 GTAACTTCCAAGTGTTGCCATGG + Intergenic
1143516208 17:7420456-7420478 GCAACAGGACAGAGTTGCCCAGG - Exonic
1145724604 17:27106887-27106909 GCAACTTCCAAATGTTGCCATGG + Intergenic
1150069543 17:62139543-62139565 GCAGCTTGGAGGTGTTGACCGGG + Intergenic
1155119586 18:22804643-22804665 GCAACTTGGAAGTGTGTCACAGG + Intronic
1157233924 18:45945319-45945341 GCAACTTGCAAACCTTGCCCAGG - Intronic
1157699007 18:49747906-49747928 GCAACGTGGAAGTGTGTCCCAGG - Intergenic
1159733300 18:72060104-72060126 ACAAATTAAAAATGTTGCCCTGG - Intergenic
1160727666 19:624739-624761 GCAGCTTGGAGGTGTTGACCGGG + Exonic
1163265459 19:16217988-16218010 GTAACTTCCAAGTGTTGCCACGG - Intronic
1165042122 19:33076053-33076075 GCAATTTTGCAGTGTTGCCCAGG - Intergenic
925496407 2:4454606-4454628 TCAACTTGAATGTGTTGTCTTGG - Intergenic
927267746 2:21172063-21172085 GCAAATTGGAAGTGTTTCCCAGG - Intergenic
927536692 2:23867286-23867308 ACAACTTGAGAGTATTACCCAGG - Intronic
928762774 2:34604330-34604352 GTAACTTCATAGTGTTGCCATGG - Intergenic
928905613 2:36364244-36364266 GCTACTTAAAAGTGTGGTCCTGG - Intronic
931208921 2:60173963-60173985 GCACCTTAAAAGTTTTGTCCAGG - Intergenic
931390249 2:61836009-61836031 GCTATTTGAAAGAGTTGCTCAGG - Exonic
933233003 2:79830523-79830545 TCTACTTCACAGTGTTGCCCAGG + Intronic
934979396 2:98827583-98827605 TCAAATTGAAAGTATTGGCCGGG - Intronic
937170673 2:119864016-119864038 GCAACTTGCAAGTGTATCCTGGG - Intronic
938056451 2:128218988-128219010 GCAACTATAAAGGGTAGCCCAGG - Intergenic
938393348 2:130922418-130922440 GCAACTTGGAAGTGTGTCCCAGG - Intronic
938832784 2:135070229-135070251 GCAACTTGGAAATGTGTCCCGGG + Intronic
940063327 2:149597516-149597538 GAAACTGCAAAGTGTTCCCCAGG - Intergenic
944966962 2:204945767-204945789 GGACCTTGAATGTCTTGCCCAGG - Intronic
946586790 2:221198247-221198269 GCAACTTGGAAGTGTGTCCCGGG - Intergenic
947515046 2:230796015-230796037 GCAACTTGAAGGAGTTCCCAAGG - Intronic
947533490 2:230927157-230927179 GAAACTTAACAGTGGTGCCCTGG - Intronic
947831584 2:233145502-233145524 GCAACTTGATAGAGGTGACCTGG + Intronic
948859437 2:240745802-240745824 GGAAGGTGAAGGTGTTGCCCAGG + Exonic
1170136605 20:13081116-13081138 GCAACTTGGAAGTGTGTCCTGGG - Intronic
1170411806 20:16100580-16100602 GCAACTTGAAGATGTTCACCTGG + Intergenic
1171404317 20:24899762-24899784 GCAACTTGGAAATGTGTCCCAGG + Intergenic
1175292938 20:57890430-57890452 GTAACTTCCAAGTGTTGCCATGG + Intergenic
1175787351 20:61720343-61720365 GCAACTTGAGAGTGATGCAGGGG + Intronic
1178890255 21:36514945-36514967 GCGACTTGAAAGTGTTTCAGGGG + Intronic
1184216171 22:43068744-43068766 GTAACTTGTGAGTGTTGCCCAGG - Intronic
950170425 3:10835242-10835264 GCAGCTTAAAAATGCTGCCCAGG - Intronic
951492257 3:23284474-23284496 GCAACTTGGAAGTGTGTCCTGGG + Intronic
952344224 3:32468973-32468995 GCAACTTGCAAGTGCTGCAGGGG + Intronic
952495257 3:33910211-33910233 GCAGCTTAAAAGTGTTTCACAGG - Intergenic
953805562 3:46064789-46064811 GCCACTTGGAAGAGTTACCCAGG + Intergenic
956442038 3:69289987-69290009 GCAACTTGGAAGTGTGTCCTAGG + Intronic
959966493 3:112361563-112361585 GCACCCTGAAAGTGATTCCCTGG + Exonic
960341094 3:116475982-116476004 ACAACTTGAAAGTGTTATTCAGG + Intronic
960858729 3:122129657-122129679 GTAACTTGCAGGTGTTGCCATGG + Intergenic
961041949 3:123683830-123683852 GCTACTTGAAAGGGTTGCTTTGG - Intronic
962006250 3:131352753-131352775 GGAACTTGAGTGTGTTTCCCAGG + Intergenic
962676500 3:137762117-137762139 GCAACTGGAAAGGATTGTCCTGG + Intergenic
965969884 3:174542088-174542110 GCAACTTCCAGGTGTTGCCGTGG + Intronic
966215529 3:177498369-177498391 GGGAATTGAAAGTGTTGCCAAGG - Intergenic
967846349 3:194046113-194046135 GAAACTTGAAAGTGTTGCCAAGG + Intergenic
968519634 4:1029651-1029673 CTAACTTGAAAGTGCTGCCCAGG + Intergenic
969047507 4:4347207-4347229 GCAATTGGACAGTGTTTCCCAGG + Intergenic
972643197 4:40943825-40943847 CCAACTTGAAAGTGATGGGCTGG - Intronic
972770079 4:42189559-42189581 TCAACTTGCAAGAGTTGGCCAGG + Intergenic
973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG + Intergenic
976399419 4:84590674-84590696 GCAACTTGGAAGTATGTCCCAGG - Intronic
978317124 4:107450655-107450677 GCAACTTGAAAGTGTTTTGTGGG + Intergenic
980150130 4:129036164-129036186 GTAACTTGAAAGTGTTAATCAGG - Intronic
980271625 4:130591521-130591543 GCAACTGGAAACTTTTGCCTTGG + Intergenic
988896671 5:35682156-35682178 GCAGCTTGAATGTCTTGCCATGG + Intronic
988933822 5:36063229-36063251 TCAATATGAAAGTGTTGCTCAGG - Intronic
989191433 5:38673499-38673521 GCCACTGGAAAGTTTTGACCAGG + Intergenic
992792838 5:80228727-80228749 GCAACTTAAAATTTTTGTCCTGG - Intronic
993252103 5:85541060-85541082 GCATCTTGAAAGTGAGGACCAGG - Intergenic
993501403 5:88671835-88671857 GCAAAATGAAAGTATTGCCCTGG + Intergenic
999422325 5:151455729-151455751 GCAACTTGGAAGTGTGTCCCGGG - Intronic
1000718920 5:164681442-164681464 GAAACTTGAAAGTGATGAACTGG - Intergenic
1001537828 5:172510879-172510901 GTAACTTGGAAGTGTTTTCCAGG - Intergenic
1002429238 5:179193484-179193506 GCAACTAGAAACTGTATCCCGGG + Intronic
1002692575 5:181060370-181060392 TCACCTTGAAATTTTTGCCCCGG - Exonic
1003962587 6:11222672-11222694 GCAACTTTAAAGTATTTCTCTGG - Intronic
1006842947 6:37042239-37042261 GCAACTACAAAGGTTTGCCCAGG - Intergenic
1008866810 6:56221975-56221997 TAAAATTGAAAGTGTTGGCCAGG + Intronic
1014147007 6:118009560-118009582 GCAAGTGGACAGTTTTGCCCAGG + Intronic
1014490950 6:122060991-122061013 GCAACTTCCAGGTGTTGCCATGG + Intergenic
1015883840 6:137896102-137896124 TAAAATTGAAAGTGTTGACCAGG - Intergenic
1016229148 6:141781371-141781393 AAAACCTGAAAGTGTAGCCCTGG + Intergenic
1019529960 7:1498504-1498526 CCAACTTGATGGTGGTGCCCAGG + Exonic
1023187482 7:37547377-37547399 GCAACTCTAATGTGTGGCCCAGG - Intergenic
1024622561 7:51174807-51174829 GCAACCTGAAAGTGTGTCCTAGG + Intronic
1026128069 7:67596997-67597019 GTAACTTCCAAGTGTTGCCATGG + Intergenic
1026244644 7:68608255-68608277 GCAACTTGAAATTTTTGAGCTGG + Intergenic
1027261375 7:76467088-76467110 GCAGCTTCACTGTGTTGCCCAGG + Intronic
1027312758 7:76965197-76965219 GCAGCTTCACTGTGTTGCCCAGG + Intergenic
1028712395 7:93924189-93924211 GCAACTTGCAAGTTTTGTCTGGG - Intronic
1028792966 7:94874467-94874489 GCAACTTGGAAGTGTGTCCTGGG - Intergenic
1031623746 7:123968326-123968348 GCAACTTCCAGGTGTTGCCATGG + Intronic
1032264921 7:130363982-130364004 GACACTTGAAACTATTGCCCTGG - Intronic
1035485350 7:159219441-159219463 GCAACTTGGAAGTGTGTCCCAGG - Intergenic
1036506263 8:9359403-9359425 GCAACATTAAAGTTTTTCCCAGG - Intergenic
1039499781 8:38007445-38007467 GCAACTTGGAAGTGTTTTCTGGG - Intergenic
1039962672 8:42261696-42261718 GCAACTTGGAAGTGTGTCCCGGG + Intergenic
1040436511 8:47396975-47396997 TGCACTTGCAAGTGTTGCCCTGG - Intronic
1040570204 8:48601898-48601920 GCAAAGTAAAAATGTTGCCCTGG + Intergenic
1040836461 8:51736621-51736643 GCAACCTGAAAGTGTGTCCCTGG + Intronic
1044083152 8:87909775-87909797 GCAACTTGGAAGTGTTTCTTGGG - Intergenic
1044137374 8:88604134-88604156 GTAACTTCAAGGTGTTGCCATGG + Intergenic
1044151722 8:88785831-88785853 AGAACTTGAAAATGTTGCCTAGG + Intergenic
1044333676 8:90950734-90950756 GCTATGTGAAAGTGTTGGCCTGG - Intronic
1045691193 8:104761761-104761783 GCAACTTGGAAGCGTATCCCAGG - Intronic
1047398552 8:124526239-124526261 GCAACTTGGAAGTGTGTCCTGGG + Intronic
1049000399 8:139822363-139822385 GTAAAATGAAAGGGTTGCCCAGG + Intronic
1050353044 9:4758788-4758810 GCAACTTGAAAGTGTGTCCCAGG + Intergenic
1051654002 9:19360897-19360919 GTAGCTAGAAAATGTTGCCCAGG + Intronic
1052749689 9:32477099-32477121 GGAACTAGAAAGTGTTTCCAGGG - Exonic
1053013992 9:34651542-34651564 GGAACTTGGGAGTGTTGCCCTGG + Exonic
1053318794 9:37077077-37077099 TCAACTTGAAAGTGTTGGCCAGG + Intergenic
1056566503 9:87777397-87777419 GAAACTTGGAAGTGTGTCCCTGG + Intergenic
1056893855 9:90522648-90522670 GCAACTTGCAAGTATGTCCCAGG - Intergenic
1056951548 9:91044239-91044261 GCAACTTGGAAGTGTGTCCCAGG + Intergenic
1057172340 9:92970387-92970409 GCAACTTGGAAGTGTCTCCCTGG - Intronic
1059080938 9:111249341-111249363 GCAACTTGGAAGTGTGTCCCAGG - Intergenic
1059723935 9:116987426-116987448 GCCAGTGGAAAGGGTTGCCCTGG - Intronic
1189124440 X:38431239-38431261 GCAACTTGGAAGTGTGTCCTGGG + Intronic
1192215694 X:69156682-69156704 GCAGGCTGAAAGGGTTGCCCAGG + Intergenic
1193148392 X:78101072-78101094 GCAACCTGGAAGTGTGTCCCAGG - Intronic
1195971251 X:110476010-110476032 GCTACCTTAAAGTGCTGCCCAGG - Intergenic
1197586741 X:128357357-128357379 GCAACTTGAAAATATTACCAAGG + Intergenic
1198731605 X:139736461-139736483 GCAACTTGGAAATCTTTCCCTGG + Intronic
1200153904 X:153965139-153965161 GCCACTTGAAAGTGCTGCTCTGG - Intronic