ID: 1137271000

View in Genome Browser
Species Human (GRCh38)
Location 16:46902073-46902095
Sequence GTGTGTCTGATGCGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137270993_1137271000 15 Left 1137270993 16:46902035-46902057 CCCCAACTGAGAGGCAGGGGGAG 0: 1
1: 0
2: 3
3: 29
4: 326
Right 1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 169
1137270996_1137271000 13 Left 1137270996 16:46902037-46902059 CCAACTGAGAGGCAGGGGGAGGG 0: 1
1: 0
2: 3
3: 61
4: 552
Right 1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 169
1137270994_1137271000 14 Left 1137270994 16:46902036-46902058 CCCAACTGAGAGGCAGGGGGAGG 0: 1
1: 0
2: 2
3: 51
4: 391
Right 1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 169
1137270992_1137271000 16 Left 1137270992 16:46902034-46902056 CCCCCAACTGAGAGGCAGGGGGA 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 169
1137270986_1137271000 24 Left 1137270986 16:46902026-46902048 CCTGGAAGCCCCCAACTGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 202
Right 1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137271000 Original CRISPR GTGTGTCTGATGCGAGTGTC TGG Intronic
901242889 1:7705038-7705060 GTGTTTCTGGCGCGAGTGTGCGG + Intronic
904541942 1:31239378-31239400 GTGTGTCTGGTGCGTGTGCCCGG - Intronic
905477638 1:38240048-38240070 GTGTGTGTGATGGGAGTAACAGG - Intergenic
908461125 1:64349073-64349095 GTGTGTGTGATGTGTGTGTTGGG + Intergenic
910986653 1:93011620-93011642 CTCGGTCTGATGCAAGTGTCAGG - Intergenic
911075061 1:93865144-93865166 GTGTGTCAGATGACATTGTCTGG + Intergenic
912581175 1:110722364-110722386 GTGTGTGTGATGTGTGTGTAGGG + Intergenic
914753972 1:150552905-150552927 AGGTGTCTGAAGAGAGTGTCCGG - Exonic
916525768 1:165607702-165607724 GTGTGTGTGATGTGTGTGTGTGG - Intergenic
920191246 1:204195245-204195267 GTGTGTATGATGTGTGTGTATGG - Intronic
920558794 1:206923715-206923737 GTGTGTCTGAGGTGTGTGTAAGG + Intergenic
924934147 1:248754393-248754415 GTGTGTTTGATGTGTGTGACAGG - Intronic
1063233206 10:4086488-4086510 GTGGGTCTGCTGGGAGGGTCTGG - Intergenic
1063385176 10:5612026-5612048 GCGTGTCTAATGTGAGTTTCAGG + Intergenic
1067469461 10:46525491-46525513 GTGTGTGTGATGTGTGTGTGTGG - Intergenic
1067848799 10:49742447-49742469 GTGTGTGTGGTGCGTGTGTGTGG - Intronic
1068023612 10:51616372-51616394 GTGTGGGTGATGGCAGTGTCAGG + Intronic
1069528919 10:69200566-69200588 ATGTGTCTGAGGTGAGAGTCTGG - Intronic
1069603542 10:69725217-69725239 GAGTGCCTGATGGGAGTTTCTGG + Intergenic
1070953642 10:80450523-80450545 GAGTGTCAGATGTGACTGTCTGG + Intergenic
1071504453 10:86224169-86224191 CTGTGTATGCTGGGAGTGTCGGG - Intronic
1071614311 10:87060960-87060982 GTGAGTCTGATGGGAGTATATGG - Exonic
1073514489 10:104064590-104064612 ATGTGTCTGTTTCCAGTGTCAGG - Exonic
1075801620 10:125158545-125158567 GAGAGTCTGATGCGAGTGGCTGG - Intronic
1076481962 10:130790710-130790732 GTGTGTCTGTTGTGTGTGTGTGG - Intergenic
1076581150 10:131512711-131512733 GAGTGTGTGATGCGTGTGTGTGG + Intergenic
1076900990 10:133337345-133337367 GTGTGTGTGGTGTGTGTGTCGGG - Intronic
1076901015 10:133337526-133337548 GTGTGTGTGAGGTGTGTGTCAGG - Intronic
1076901046 10:133337813-133337835 GTGTGTGTGAGGTGTGTGTCTGG - Intronic
1076901066 10:133337905-133337927 GTGTGTCAGATGTGTGTTTCTGG - Intronic
1076901070 10:133337944-133337966 GTGTTTCTGGGGAGAGTGTCAGG - Intronic
1076901269 10:133339294-133339316 GTGTGTCTGATGCATGTGTGAGG - Intronic
1077029705 11:459513-459535 GGGGGTCTCAGGCGAGTGTCTGG + Intronic
1079647936 11:22890963-22890985 GAGAGTCTGATGGGAGTATCTGG + Intergenic
1083437072 11:62649822-62649844 GTGTCTTTGATGAGAGTGTCCGG - Exonic
1084400566 11:68940607-68940629 GTGTGTCTGCTGCGGGTCTAAGG + Intergenic
1091599150 12:1907653-1907675 GCGTGTCTGGTGGGCGTGTCTGG + Intronic
1091599158 12:1907692-1907714 GTGTGCCTGGTGGGCGTGTCTGG + Intronic
1091599173 12:1907743-1907765 GCGTGTCTGGTGGGTGTGTCTGG + Intronic
1091599186 12:1907795-1907817 GTGTGCCTGGTGGGCGTGTCTGG + Intronic
1092074635 12:5662976-5662998 GTGTGTCTGCAGGAAGTGTCAGG - Intronic
1093993490 12:25616079-25616101 GTGTGTGTTATGTGTGTGTCGGG - Intronic
1095779490 12:46043772-46043794 GTGTGTGTGTTGCGAGGGTGGGG + Intergenic
1099796644 12:87409021-87409043 GTGTCTGTGATGGGAGTGTCTGG - Intergenic
1101211194 12:102536385-102536407 GTGTGTGTGATGGAAGAGTCAGG - Intergenic
1104872071 12:132006936-132006958 GTGTGTTTGATGGGAGTGTGGGG + Intronic
1105853503 13:24356738-24356760 GTGTGTGTGATGAGTGTGTGTGG - Intergenic
1105853514 13:24357235-24357257 GTGTGTGTGATGAGTGTGTGTGG - Intergenic
1105853530 13:24357404-24357426 GTGTGTGTGATGAGTGTGTGTGG - Intergenic
1105853536 13:24357465-24357487 GTGTGTGTGATGAGTGTGTGCGG - Intergenic
1106837422 13:33650035-33650057 GTTTGTTTCATGTGAGTGTCTGG - Intergenic
1107185578 13:37515685-37515707 GTGTGTCTGATGACAGTCTGTGG - Intergenic
1108727583 13:53200050-53200072 CTGTGGCTGCTGCTAGTGTCAGG + Intergenic
1113899239 13:113787509-113787531 GTGTGGATGGTGCGAGTGTAGGG + Intronic
1118693942 14:68365260-68365282 CTGTGTCTGATTCGGCTGTCCGG + Intronic
1118810467 14:69269820-69269842 GTGTGTATGATGTATGTGTCGGG + Intronic
1119732022 14:76957079-76957101 GTGTGTGTCATACGTGTGTCTGG + Intergenic
1124121549 15:26893106-26893128 GTGTGTCTAGTGCGTGTGTATGG + Intronic
1127625491 15:60776228-60776250 GTGTGTCTAATAAGAGTGGCGGG - Intronic
1128647112 15:69386246-69386268 GTGTGTGTGATGTGTGTGTGTGG - Intronic
1128761060 15:70216219-70216241 GAGTGTGTGGTGGGAGTGTCGGG + Intergenic
1128770365 15:70277365-70277387 GTGTGCCTGCTGCAAGTGTGTGG - Intergenic
1128875748 15:71199806-71199828 GTGTGTGTGATGCACGTGTGGGG + Intronic
1129674278 15:77623909-77623931 GTGTGACTGATGTGTGTGTGTGG + Intronic
1131943530 15:97593697-97593719 GTGTGTCTTATGTGTGTGTTAGG + Intergenic
1132640917 16:978005-978027 GTGTGTATGATGTGTGTGTGTGG - Intronic
1133748488 16:8706047-8706069 GTGTGCCTGTTGGGAGTGTTGGG + Intronic
1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG + Intronic
1137501674 16:49016402-49016424 GTGTGTGTGATGTGTGTGTGTGG + Intergenic
1137671750 16:50283387-50283409 GGGTGTCTGCTGACAGTGTCAGG + Intronic
1137891663 16:52169542-52169564 GTGTGTCTGTAGGGTGTGTCTGG + Intergenic
1138944674 16:61834263-61834285 GTGTGTCTGGTGGGAGGGTGGGG + Intronic
1141236272 16:82220383-82220405 GTGTGTGTGATGTGTGTGTGTGG + Intergenic
1143748746 17:9013040-9013062 GTGTGTGTGTTGTGTGTGTCAGG + Intergenic
1148612362 17:48972798-48972820 GTGTGTGTGATGTGACTGTGGGG - Intergenic
1151732022 17:75917403-75917425 ATGTGACAGATTCGAGTGTCAGG + Intronic
1152481403 17:80556065-80556087 GAGTGTCTCATGTGAGTCTCGGG - Intronic
1152481493 17:80556733-80556755 GTGAGTCTCATGTGAGTTTCAGG + Intronic
1152606200 17:81291834-81291856 AGGTGTCTAGTGCGAGTGTCTGG - Intronic
1152947201 17:83204384-83204406 GTGTGTCTGGTGAGTGTGTCTGG - Intergenic
1156721815 18:40079343-40079365 ATGTGGCTAATGCAAGTGTCAGG - Intergenic
1160039397 18:75332455-75332477 GTGTGTCTGATTCTAGAGACGGG + Intergenic
1160742033 19:690884-690906 GTGTGCCTGATCCCCGTGTCCGG + Intronic
1161477137 19:4492778-4492800 GTGTGTCTGGTGTGTGTTTCTGG + Intronic
1161905458 19:7153213-7153235 GTGTGTGTGGTGCGTGTGTGTGG - Intronic
1162569764 19:11464951-11464973 GTGTGTCTGGTGCGTGTGTGTGG - Intronic
1163269207 19:16240294-16240316 GTGTGTGTGATGTGCGTGTGTGG + Intronic
1164964583 19:32471334-32471356 GTGTGTCTGCTTTGACTGTCTGG - Intronic
1165070066 19:33249795-33249817 GTGTGTGTGATGTGTGTGTGAGG - Intergenic
1165111693 19:33506187-33506209 GTGTTTGTGATGAGAGTGTGTGG - Intronic
1165286921 19:34850270-34850292 ATGTCTCTGATGAGAGTGTGAGG - Intergenic
1165743960 19:38219388-38219410 GTGTCTCCTCTGCGAGTGTCTGG - Intronic
1168305815 19:55434684-55434706 GTGTGTATGGTGCGTGTGTGTGG + Intronic
925141704 2:1554979-1555001 GTATGTGTGATGCGTGTGTGTGG + Intergenic
927145773 2:20164712-20164734 GTGTGTGTGGTGCGAATGTGTGG - Intergenic
927145798 2:20164992-20165014 GTGTGTGTGGTGTGAGTGTGTGG - Intergenic
927145818 2:20165203-20165225 GTGTGTGTGGTGGGAGTGTGTGG - Intergenic
927245426 2:20953599-20953621 GTGTGTGTGATGTGTGTGTGTGG + Intergenic
932429486 2:71665583-71665605 GTGAGTCTGAAGCCAGTGTCAGG + Intronic
935728945 2:106048957-106048979 TTGTGTGTGTTGTGAGTGTCTGG + Intergenic
936050770 2:109222168-109222190 GAGTGCCAGATGCCAGTGTCTGG + Intronic
938749257 2:134313188-134313210 GTGTGTCTGTTGGGACTGTCAGG + Intronic
947078928 2:226374051-226374073 GTATGTCTGATTCAAGTATCAGG - Intergenic
948336595 2:237212954-237212976 GTGTGTGTGATGTGTGTGTAAGG + Intergenic
948563708 2:238870465-238870487 GTGTGTGTGTGGCGTGTGTCGGG - Intronic
948907210 2:240985610-240985632 GTGTGTGTGGAGTGAGTGTCTGG - Intronic
1175884024 20:62278187-62278209 GTGTGTCTGTTGCCAGCGTTAGG + Intronic
1175884030 20:62278281-62278303 GTGTGTCTGTTGCCAGCGTTAGG + Intronic
1175884051 20:62278602-62278624 GTGTGTCTGTTGCCAATGTTAGG + Intronic
1176990141 21:15485918-15485940 GTGTGTCAGATGTCAGTGTCAGG + Intergenic
1179769666 21:43605371-43605393 GTGTGTGTGGTGTGTGTGTCGGG - Intronic
1179873600 21:44256261-44256283 GTGTGTCTTATGTGTGTCTCCGG - Intronic
1180090190 21:45530393-45530415 GTGTGTGTGGTGTGAGTGCCTGG + Intronic
1183267511 22:36838340-36838362 GTGTGTGTGATGTGTGTGTGGGG + Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG + Intronic
1184457204 22:44617660-44617682 GTGTGTGTCATGTGTGTGTCTGG - Intergenic
957905190 3:86543924-86543946 GTGTGTGTGATAAGAGTGTCAGG - Intergenic
963206187 3:142638011-142638033 GTGTGTGAGATGTGAGTGTAGGG + Intronic
966625173 3:182008139-182008161 ATGAGTCTGATGGGAGTGGCAGG - Intergenic
967279514 3:187808435-187808457 GTGTGCCTTATGCAAGTTTCTGG + Intergenic
967878964 3:194285761-194285783 GAGTGTGTGATGCGCGTGTGTGG + Intergenic
968651693 4:1762711-1762733 GTGAGTGAGATGCGTGTGTCTGG + Intergenic
969410909 4:7027564-7027586 GGGTGTGTGATGTGCGTGTCGGG - Intronic
972386046 4:38566798-38566820 ATGTGGCTGATGAGAGGGTCAGG - Intergenic
972406816 4:38754203-38754225 GTGTGTATGAAGCGTGTGTGGGG - Intergenic
975371544 4:73594428-73594450 GTCTGTCTGATTCCAGAGTCTGG - Intronic
980867311 4:138567799-138567821 GTGTGTGTGGTGCGTGTGTGTGG - Intergenic
986127869 5:4900066-4900088 GTGTGTCTTATGGGAGGGACAGG - Intergenic
987429183 5:17811135-17811157 GTGTGTTTGAGGCAAGTGTTAGG - Intergenic
990629307 5:57650805-57650827 GTCTGTCTGACCCGAATGTCTGG - Intergenic
991405325 5:66295557-66295579 GTGTGTCTGTTGACCGTGTCAGG + Intergenic
995858425 5:116617574-116617596 ATGTGTCTGTTGAGAGTGTGTGG - Intergenic
998321598 5:141236811-141236833 GTGTGTCTGACGGGAGGCTCAGG + Intergenic
998322154 5:141242166-141242188 GTGTTTCTGACGCGAGGCTCCGG + Intergenic
1000372165 5:160547574-160547596 GTATGCCTGAGGTGAGTGTCAGG + Intergenic
1004240682 6:13918303-13918325 GTGTCTCTGATGGGAGGGTTTGG + Intergenic
1004862601 6:19820340-19820362 GTGTTTCTGATGCCACTGTCAGG - Intergenic
1007548237 6:42709951-42709973 GTGTCTGTGATGTGAGGGTCAGG + Intronic
1008757428 6:54813778-54813800 GTATCTCTGATGGGAGTGTAGGG - Intergenic
1011427596 6:87247258-87247280 GTGTGTGTGTTGCGGGTGGCAGG - Intronic
1012323065 6:97876671-97876693 GTGTCTCTGTTGCGAGTGGAGGG + Intergenic
1022230054 7:28405881-28405903 GTGATTCTGATGCAAGCGTCTGG - Intronic
1022393045 7:29960144-29960166 GTGTGTATGTTGCGGGAGTCGGG - Intronic
1028138865 7:87249779-87249801 GTGGTTCTGATTCTAGTGTCTGG - Intergenic
1030845945 7:114411358-114411380 GTGTGTCTGATTTGAGTTACAGG - Intronic
1032239833 7:130152052-130152074 GTGTGTGTGATGTGTGTGTGAGG - Intergenic
1032395583 7:131587116-131587138 GTGTGTATGGTGTGAGTGTGTGG + Intergenic
1035065480 7:156101314-156101336 GTGTGTCTGCTGTGTGTGTCTGG + Intergenic
1035065491 7:156101581-156101603 GCGTGTCTGGTGTGTGTGTCTGG + Intergenic
1035407612 7:158609830-158609852 GTGTGTGTGAGGGGAGTGTGAGG + Intergenic
1037387140 8:18355286-18355308 GTGTGTATGATGGGAATGCCAGG - Intergenic
1040474367 8:47763700-47763722 GTGTGTGTGATATGAGTGTGGGG + Intergenic
1042952842 8:74219438-74219460 GTGTGCCTGATGCCAGTCTTAGG - Intergenic
1044603715 8:94031119-94031141 ATGTGTGTGATGCGGGGGTCAGG + Intergenic
1045383848 8:101652417-101652439 GTGTGTGTGGTGTGTGTGTCTGG + Intronic
1046584260 8:116131936-116131958 GTGTGTCTCGTGTGTGTGTCTGG - Intergenic
1046912720 8:119646461-119646483 GTGCTTCTGATGCGAGTTTGAGG + Intronic
1048292939 8:133194285-133194307 GTGTGTCTGGTGTGTGTGTGTGG + Intronic
1049049089 8:140178597-140178619 GTGTCTCTGATGTTGGTGTCAGG + Intronic
1049241770 8:141541290-141541312 GTGTGTGTGGTGTGAGTGTGGGG - Intergenic
1049335441 8:142082120-142082142 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335454 8:142082189-142082211 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335500 8:142082428-142082450 TTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335508 8:142082472-142082494 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335584 8:142082881-142082903 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335591 8:142082920-142082942 GTGTGTCTGGAGTGTGTGTCTGG - Intergenic
1049335594 8:142082950-142082972 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335599 8:142082976-142082998 GTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335602 8:142082989-142083011 GTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335607 8:142083019-142083041 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335620 8:142083088-142083110 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335641 8:142083210-142083232 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335658 8:142083330-142083352 GTGTGTCTGTGGTGTGTGTCTGG - Intergenic
1049335662 8:142083375-142083397 GTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049535954 8:143182236-143182258 GTGTGGCTGATGCGAGTAGGAGG - Intergenic
1050580513 9:7050244-7050266 CTGTGGCTGATGTGAGTGTTGGG + Intronic
1054741301 9:68808415-68808437 GTGTATCTGGTGATAGTGTCGGG - Intronic
1056689212 9:88792228-88792250 GTGTGTGTGATGTGTGTGTGTGG + Intergenic
1056910315 9:90694656-90694678 GTGTGTGTGATGTGAGTGTGTGG + Intergenic
1059467918 9:114481114-114481136 GTTTGTCTGTTGAGAGTGTTGGG - Intronic
1060296005 9:122343280-122343302 GTGGGTCTGATGTGAGGGTGGGG - Intergenic
1060662009 9:125410025-125410047 GTGTGTGTGGTGTGTGTGTCTGG - Intergenic
1060824418 9:126679827-126679849 GTGTGTCTGAGGCCAGAGTCAGG - Intronic
1061995866 9:134182850-134182872 GTGTGTGTGGTGCGTGTGTGTGG + Intergenic
1187205559 X:17177885-17177907 GTGTGTCTGCTGTCAGTGTCTGG + Intergenic
1192141866 X:68652912-68652934 GTGTGTGTGATGTGTGTGTGTGG - Intronic
1192808839 X:74532278-74532300 GTGGGACTGATGCTAGTGTTAGG - Exonic
1196965358 X:121048676-121048698 GTGAGTCTGATGGGAGTATATGG + Exonic