ID: 1137274903

View in Genome Browser
Species Human (GRCh38)
Location 16:46926994-46927016
Sequence CTCTGCCCAAAGCCACTGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 301}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137274903_1137274912 24 Left 1137274903 16:46926994-46927016 CCCGGCAGTGGCTTTGGGCAGAG 0: 1
1: 1
2: 1
3: 26
4: 301
Right 1137274912 16:46927041-46927063 TGACTTCCTCTCCGCACTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 56
1137274903_1137274910 22 Left 1137274903 16:46926994-46927016 CCCGGCAGTGGCTTTGGGCAGAG 0: 1
1: 1
2: 1
3: 26
4: 301
Right 1137274910 16:46927039-46927061 TATGACTTCCTCTCCGCACTAGG 0: 1
1: 0
2: 1
3: 4
4: 79
1137274903_1137274908 -1 Left 1137274903 16:46926994-46927016 CCCGGCAGTGGCTTTGGGCAGAG 0: 1
1: 1
2: 1
3: 26
4: 301
Right 1137274908 16:46927016-46927038 GGGAAGGCACTTACCACTTCAGG 0: 1
1: 1
2: 0
3: 11
4: 137
1137274903_1137274911 23 Left 1137274903 16:46926994-46927016 CCCGGCAGTGGCTTTGGGCAGAG 0: 1
1: 1
2: 1
3: 26
4: 301
Right 1137274911 16:46927040-46927062 ATGACTTCCTCTCCGCACTAGGG 0: 1
1: 0
2: 0
3: 4
4: 67
1137274903_1137274913 28 Left 1137274903 16:46926994-46927016 CCCGGCAGTGGCTTTGGGCAGAG 0: 1
1: 1
2: 1
3: 26
4: 301
Right 1137274913 16:46927045-46927067 TTCCTCTCCGCACTAGGGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137274903 Original CRISPR CTCTGCCCAAAGCCACTGCC GGG (reversed) Exonic
900185441 1:1331138-1331160 CTCTGCCTGAGGCCACTGCCAGG - Intergenic
900211069 1:1456119-1456141 CTCTGCCCAGCGTCCCTGCCTGG - Intronic
900223976 1:1524167-1524189 CTCTGCCCAGCGTCCCTGCCTGG - Intronic
900354159 1:2251975-2251997 GTCTGGGCACAGCCACTGCCAGG - Intronic
901472599 1:9468060-9468082 TTCTGGCCAAGGTCACTGCCAGG - Intergenic
901526403 1:9825478-9825500 CCCTTCCCAAAGCACCTGCCTGG + Intergenic
901868493 1:12123579-12123601 CTCTGCCCCGAGTCTCTGCCAGG - Intronic
902397281 1:16139215-16139237 CCCTGCCCTAAGCCCCTTCCTGG + Intronic
902514809 1:16984411-16984433 CCCTGCCCAAAGAAACAGCCAGG - Intergenic
902519476 1:17007890-17007912 CTGTGCCCACAGCAGCTGCCTGG - Intronic
903642861 1:24871586-24871608 CTCTGCCACAAGCCCCTGGCTGG - Intergenic
904533683 1:31185212-31185234 CTCTGCCCTATGGCACTGCCAGG + Intronic
904598261 1:31660104-31660126 CACTGATCAAAGGCACTGCCTGG + Intronic
904788687 1:33001466-33001488 CTCTGCCCCAAGTGGCTGCCTGG + Intergenic
906662702 1:47593859-47593881 CTGTCCCCAAAGCCCTTGCCAGG - Intergenic
906692271 1:47800386-47800408 CTCTGCCGAATGCCTCTCCCAGG - Intronic
906700212 1:47852231-47852253 CTCTGCCCCAAACCTCCGCCTGG - Intronic
912269201 1:108192427-108192449 CTCTGCCCAATGCCTCTCCAGGG + Intronic
915287030 1:154859586-154859608 CTCAGCTCAAAGCCACTGACAGG + Intronic
915492410 1:156258495-156258517 CTCTGCTCAAAGCCCCTTTCAGG + Intronic
918054008 1:181002851-181002873 CTCTGCCCACAGCCACAGGAGGG + Intronic
920927769 1:210358739-210358761 GTCTGACACAAGCCACTGCCAGG - Intronic
921948290 1:220904147-220904169 CTCTACCCACAGCCACAGCTGGG - Intergenic
922802731 1:228371649-228371671 CCCTGGCCACAGCCACTCCCTGG + Exonic
1065961655 10:30738735-30738757 CTCTGTCCAAAGCCGTTGGCTGG - Intergenic
1066220629 10:33334636-33334658 CTCTTCCAGGAGCCACTGCCCGG + Exonic
1067750059 10:48965604-48965626 CTCTGCCCATGTCCACAGCCTGG + Intronic
1067798865 10:49342943-49342965 GTCTGTACCAAGCCACTGCCGGG - Intergenic
1067944785 10:50682848-50682870 CCCTGCCCTCGGCCACTGCCTGG + Intergenic
1069530971 10:69219205-69219227 CTCTTCCCACAGTCACTGGCTGG - Intergenic
1069688519 10:70334703-70334725 CTCTGCCCACACCCACCCCCAGG + Intronic
1069792123 10:71029619-71029641 CTCTGCCCACAGTCCCTGCACGG + Intergenic
1069993689 10:72329824-72329846 CTCTGCCCAAGGCCACTGGGTGG + Intergenic
1070396013 10:76011779-76011801 ACCTGCCCAAAGCCAATCCCTGG - Intronic
1070560234 10:77560775-77560797 CTGGGCCCAAACCCACTACCAGG - Intronic
1070784317 10:79154302-79154324 CTCTGCTGAGAGCCTCTGCCAGG + Intronic
1070834864 10:79441895-79441917 GGCTGCCCAGAGCCCCTGCCAGG - Intronic
1071568072 10:86681655-86681677 CTCGGCCCAAAAGCCCTGCCGGG + Exonic
1072270725 10:93773873-93773895 CTCTGCACAAACCCACGGGCTGG + Intronic
1072716756 10:97757419-97757441 CACTCCAGAAAGCCACTGCCAGG - Intronic
1073471858 10:103727489-103727511 CTCTGTGCAAAGTCATTGCCGGG + Intronic
1074399813 10:113132855-113132877 CTCTGTCCTAATCCTCTGCCAGG - Intronic
1074462468 10:113650796-113650818 CTCTGCCCAGGCCCAGTGCCTGG - Intronic
1075345164 10:121676540-121676562 CTCTGCCTTTAGCCACTTCCTGG - Intergenic
1075653459 10:124145490-124145512 TTCTGCCAATAGCCACTTCCTGG + Intergenic
1075866613 10:125727502-125727524 CTCTGACTAAAGCAACTGCCTGG + Intronic
1076486029 10:130817863-130817885 CTCTTCCCAAGGTCACTGCTTGG - Intergenic
1076789435 10:132768875-132768897 CTCTGCCCAAAACCAGGGCGGGG - Intronic
1076835701 10:133020027-133020049 CTCTGCCCCAAGTCACTGGGCGG + Intergenic
1076859235 10:133132772-133132794 AGCTGCCCAAAGCCCCTGCAGGG - Intergenic
1077018157 11:406103-406125 CTTGGCCCAGACCCACTGCCAGG + Intronic
1077096663 11:801883-801905 CTCTGCCCAGAGCCTCACCCTGG - Intronic
1077340504 11:2024284-2024306 TCCTGCCCACAGCCCCTGCCCGG + Intergenic
1077699687 11:4430163-4430185 ATCTGCACAAGGCCACTCCCAGG + Intergenic
1078422690 11:11225087-11225109 CTCAGCCCAAAGCCAGTGGATGG + Intergenic
1078469583 11:11576272-11576294 CTCTGCCTGGAGCCACAGCCTGG - Intronic
1078544329 11:12235781-12235803 GTTTGCCCAAGGCCACAGCCAGG - Intronic
1078977475 11:16495183-16495205 CCCTGCCCATAGCCACTACCTGG + Intronic
1079236816 11:18697159-18697181 CTCTCCCCAAAGCCCCTAACTGG + Intronic
1079379206 11:19922268-19922290 TTCTGCCCAAAGACACTGGGAGG - Intronic
1080760577 11:35245225-35245247 CTCTGCCCAGACCCCCTTCCTGG + Intergenic
1081398355 11:42613818-42613840 CTTTGCCCTAAGCCACTGGAAGG - Intergenic
1082997211 11:59263748-59263770 CTCTGCCCACAGCCTGCGCCTGG + Intergenic
1083331021 11:61898428-61898450 CTCTGTCCAAAGCCACAGGAGGG - Intronic
1083623868 11:64062039-64062061 TCCTGTCCAAAGCCTCTGCCTGG + Intronic
1083763751 11:64832574-64832596 CCTTGCCCCATGCCACTGCCCGG + Intronic
1084038659 11:66529207-66529229 CTCTTCCCCAAGCCACCTCCAGG - Intronic
1084529182 11:69717085-69717107 CTCTTCCCAAAGCCCCAGCCAGG + Intergenic
1084546240 11:69816490-69816512 CCCTGCCCAAAGCCACACCCCGG + Intronic
1084724539 11:70932624-70932646 CACTGACCAAAGCAAATGCCAGG + Intronic
1085019024 11:73193449-73193471 CTTTACCCACAGCCTCTGCCAGG + Intergenic
1086643257 11:89186494-89186516 CTCTGCCCAAGGCCACTGGTGGG + Intronic
1087386878 11:97483012-97483034 CTTCTCCCAAGGCCACTGCCTGG + Intergenic
1090222209 11:125037610-125037632 CCCTGCCCTGTGCCACTGCCTGG + Intronic
1090837003 11:130461233-130461255 CTCTGCCCAAACCCTATGCAGGG - Intronic
1091041406 11:132284758-132284780 TTCTCCCCAAGGCCACTGTCGGG - Intronic
1091215544 11:133899210-133899232 TACGGCCCACAGCCACTGCCAGG - Intergenic
1202823489 11_KI270721v1_random:79473-79495 TCCTGCCCACAGCCCCTGCCCGG + Intergenic
1091588264 12:1828158-1828180 CTCTGCCCAGGGCTGCTGCCCGG - Exonic
1092985173 12:13838257-13838279 CTCGGCCCAAAGCACCTGCGTGG + Intronic
1095921502 12:47535983-47536005 CTTTGCTCATAGGCACTGCCAGG - Intergenic
1097072013 12:56361982-56362004 CTGCACCCAAAGTCACTGCCTGG - Exonic
1097461729 12:59871494-59871516 CTTTGGCCAAACCCAGTGCCAGG + Intergenic
1101085689 12:101233598-101233620 CTCTGCTCAAAGGCACTGTGGGG + Intergenic
1101328207 12:103735504-103735526 ATCTTCCCACATCCACTGCCTGG + Exonic
1101427146 12:104597652-104597674 CTATCCCCAAACCCAGTGCCTGG + Intronic
1102607286 12:114077685-114077707 CTCTGCCCAAAGGCCTTTCCAGG - Intergenic
1105746716 13:23383892-23383914 CTCTCCCCAACCCCAGTGCCTGG + Intronic
1106720095 13:32427815-32427837 CCCTGCCCCAAGCCGCTCCCGGG - Intronic
1107964579 13:45587573-45587595 CTCTGCCCAAAACAACTGTGAGG - Intronic
1112792421 13:103017357-103017379 CTTTGCCCAAATCCAGGGCCTGG - Intergenic
1112901614 13:104363896-104363918 CTCTGCACCATGCTACTGCCAGG + Intergenic
1113097776 13:106684096-106684118 CTCTGCCCCAAGAGCCTGCCTGG - Intergenic
1114215735 14:20656404-20656426 CGCTGCCTTAGGCCACTGCCTGG - Intergenic
1117166793 14:53042696-53042718 CTGTGCCTCAAGCCTCTGCCAGG - Intronic
1117548071 14:56809188-56809210 CTCCGCCCAAGGCCGCGGCCGGG - Intronic
1118500978 14:66362340-66362362 CTCTGCCCAGGGCCACAGGCAGG + Intergenic
1118635884 14:67748424-67748446 CACTGCCCAAGGTCACTTCCTGG + Exonic
1121452270 14:94016544-94016566 GTCTGGCCAAAGCCACTCCATGG + Intergenic
1121801583 14:96778655-96778677 CTCTGCCCACAGCCCCTTCATGG + Intergenic
1122454259 14:101837595-101837617 CTCTGCCCCAAGGGACTCCCAGG - Intronic
1122749063 14:103919527-103919549 TTCTGTCCAAAGCCCCTACCTGG - Intronic
1123403259 15:20005951-20005973 CTCACCCCAAACCTACTGCCAGG + Intergenic
1123512597 15:21012605-21012627 CTCACCCCAAACCTACTGCCAGG + Intergenic
1124223205 15:27867522-27867544 CTCTGCTCTGAGCCTCTGCCAGG - Intronic
1124400921 15:29346472-29346494 CACTGACCACAGCCCCTGCCTGG - Intronic
1127044324 15:55010203-55010225 CTCTGCCCAAAGGCTTTCCCTGG + Intergenic
1128603438 15:69016507-69016529 CTCTGCCCCAAGTCAATGCAGGG + Intronic
1128664937 15:69531108-69531130 CCCTGCCCAAGCCCACTGGCTGG - Intergenic
1129108800 15:73325607-73325629 CTGTGCTCAAAACAACTGCCCGG + Intronic
1129225489 15:74168174-74168196 CTCTGCCCACAGTCTCTGTCTGG + Intergenic
1130322214 15:82850784-82850806 CAGTGCCCAAGGCCACTGGCAGG + Intronic
1131303875 15:91224141-91224163 CTCTGCCCACAGCCCATCCCTGG - Intronic
1131449702 15:92529049-92529071 CACTGCCCAAAGCCAAAGCTAGG - Intergenic
1132041321 15:98526563-98526585 CTTTGCCGAAAGCCACTACCTGG + Intergenic
1132342132 15:101085487-101085509 CTCTCCCCAGAGCCCCAGCCTGG + Intergenic
1134232195 16:12437860-12437882 CCCAGCCCAGGGCCACTGCCTGG + Intronic
1134280139 16:12809880-12809902 CTTTGCACAAAGTCAGTGCCTGG - Intergenic
1135568201 16:23528331-23528353 CTCTCCCCAATGGCACTGCAGGG + Intronic
1137274903 16:46926994-46927016 CTCTGCCCAAAGCCACTGCCGGG - Exonic
1139953110 16:70681366-70681388 CTCAGCCCAGATCCCCTGCCAGG - Intronic
1140136418 16:72209919-72209941 CTCTGACTACAGCCACTGCTGGG + Intergenic
1140479323 16:75253879-75253901 CTCTGCGCCCAGCCAGTGCCAGG + Intronic
1140640633 16:76967832-76967854 CACTGCCCAAAGACAGTACCTGG - Intergenic
1142178389 16:88655580-88655602 CTCTGCCCTCAGCCTCTGTCTGG - Intronic
1142183402 16:88682597-88682619 CTCTACCCAAAGCCTCAGCATGG - Intronic
1142251958 16:88996147-88996169 CTCTTCCCAGACCCAGTGCCCGG + Intergenic
1142805678 17:2369970-2369992 CTCTTCCCAGACCCACGGCCGGG - Intronic
1143544691 17:7589186-7589208 CTGTACCCAAAGCCTCTGCTCGG + Exonic
1146214925 17:30971364-30971386 CCCTGCCCACTGCCCCTGCCCGG + Exonic
1147247635 17:39132658-39132680 CTCTGCCCAGTGCCTCTGCCAGG - Intronic
1148124708 17:45230746-45230768 CTCTCCCCATAGCCCCAGCCTGG - Intronic
1148445742 17:47735885-47735907 GTCTCCCCACAGCCTCTGCCAGG + Intronic
1148457655 17:47819700-47819722 CACAACCCCAAGCCACTGCCCGG + Intronic
1148559098 17:48595949-48595971 CCCTCCCCAAAGCCACTGGAAGG - Exonic
1151220209 17:72606277-72606299 CTCTTCCCAAAGCCAATGGGAGG - Intergenic
1151275769 17:73033021-73033043 TTCATCCCAAAACCACTGCCTGG - Intronic
1151927917 17:77212386-77212408 TTCTGTCCAAAACCACTGCGAGG - Intronic
1152574745 17:81135075-81135097 CCCTTGCCAAACCCACTGCCAGG + Intronic
1152641311 17:81450431-81450453 CCCTTCCCCAGGCCACTGCCTGG + Intronic
1152928967 17:83100508-83100530 CTCTGGCCACAGCGGCTGCCAGG + Intergenic
1153027825 18:687402-687424 CTCTCCCCAGACCCGCTGCCTGG - Intronic
1154300424 18:13186632-13186654 CTCTGCCCAGGGCCACGGTCGGG + Intergenic
1155990905 18:32278315-32278337 CTCTCCCCCACGCCCCTGCCAGG - Intronic
1156450957 18:37266323-37266345 TTCTGCCCAACCCCACTGCAGGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1158885284 18:61821069-61821091 ATCTGCCCAGAGGCACTTCCTGG + Intronic
1159104276 18:63987613-63987635 CTCTGCCCACCACCACTGCCAGG + Exonic
1160148954 18:76384976-76384998 CTCTGCACAGGGCCGCTGCCAGG - Intronic
1160303604 18:77709326-77709348 CTTTGACCAATGCCACTCCCGGG - Intergenic
1160550891 18:79693179-79693201 ACCTGCTCAAAGACACTGCCAGG - Intronic
1160838219 19:1134477-1134499 CTCTGACCCAAGCCACAGCACGG + Intronic
1160937337 19:1603105-1603127 AGCCTCCCAAAGCCACTGCCTGG + Intronic
1161195213 19:2982835-2982857 CTCTGTCCAAAGCAACTGACCGG - Intronic
1161772938 19:6241263-6241285 GTGTCCCCCAAGCCACTGCCAGG + Intronic
1162575316 19:11495691-11495713 CTGTGCCCAAGGCCAGTCCCAGG - Intronic
1162752046 19:12834924-12834946 CTGTGCCCCAAGGCCCTGCCTGG + Intronic
1163319893 19:16568415-16568437 CTCTGCTCAGGGCCACAGCCCGG + Intronic
1163320370 19:16571483-16571505 ATCTGCCCAGAGTCCCTGCCCGG + Intronic
1163398423 19:17077171-17077193 CCCTGCACAAAGTCCCTGCCAGG - Intronic
1164080372 19:21857120-21857142 CACTGCCCACAGCCACTGGCTGG + Intergenic
1165114259 19:33519635-33519657 CTCTTCCCAAGGAGACTGCCAGG + Intronic
1165777556 19:38413547-38413569 CTCTTCCCAAAGCCCCTCCTGGG + Intronic
1166231032 19:41425959-41425981 CTCGGCCCGAAGCCTCTACCTGG - Exonic
1166963936 19:46516439-46516461 CCCTCCCCACTGCCACTGCCCGG + Intronic
1167468334 19:49662078-49662100 CTGGGCCCAGAGCCACTGCCCGG + Exonic
926600800 2:14843717-14843739 CTCTGCACCAAGCAGCTGCCTGG - Intergenic
926724182 2:15984568-15984590 CGCTGCCCACAGGCCCTGCCAGG + Intergenic
928614647 2:33024989-33025011 TTCTGCCAACAGCCAGTGCCAGG - Intronic
930246862 2:48992458-48992480 CTCTCCACACAGCCACTGCCAGG + Intronic
931196315 2:60055076-60055098 CTCTCCACAGAGCCACTGGCTGG + Intergenic
931872771 2:66479064-66479086 CTCAGCACAAGGCCATTGCCAGG - Intronic
932484028 2:72070197-72070219 CTCTGCCCCAGGCAACTGCTGGG + Intergenic
932737025 2:74261389-74261411 CTGTGCCCAAGGCCACAGGCAGG + Intronic
933415891 2:81985569-81985591 CTCTGCCCACGGCCCCTGCACGG + Intergenic
934716641 2:96548674-96548696 CTCTGCCCCGAGCCACTCGCTGG + Intronic
934810639 2:97273673-97273695 CCCTGCACAAAGCCTCAGCCTGG + Intergenic
934827053 2:97434266-97434288 CCCTGCACAAAGCCTCAGCCTGG - Intergenic
935951724 2:108335804-108335826 CTCTGCCGGAAGCCAATGACTGG + Intergenic
936043993 2:109172104-109172126 CTCTGCCCCAGGTCATTGCCTGG - Intronic
937916547 2:127102017-127102039 CTATGCCCCAAGCACCTGCCTGG + Intronic
938809710 2:134842178-134842200 CTCAGACCAAAACCACTCCCAGG + Intronic
943613252 2:190060195-190060217 CTCTGCCAAATACCAGTGCCTGG + Exonic
944203157 2:197129971-197129993 CTATGTGCAAAGCAACTGCCAGG - Intronic
945234011 2:207617795-207617817 CTCTGTCCACTCCCACTGCCTGG - Intronic
946073968 2:217058323-217058345 CAGTCCCCAAAGCCACTGCATGG - Intergenic
947816287 2:233039860-233039882 TTGAGCCCAACGCCACTGCCTGG + Intergenic
948332635 2:237182286-237182308 CTCTGCCCACAGCAAATGCTAGG + Intergenic
948641241 2:239377264-239377286 CACTAACCGAAGCCACTGCCAGG + Intronic
948658168 2:239489772-239489794 ATCTGCCCCAGGCCACAGCCTGG + Intergenic
948698725 2:239747513-239747535 CTCTGCCCACGCCCAGTGCCCGG + Intergenic
948773898 2:240270096-240270118 CCCTTCCCAAAGTCCCTGCCTGG - Intergenic
948840822 2:240648059-240648081 CTCTGCCCCAAGCCACTGCCTGG - Intergenic
1168862099 20:1052843-1052865 CACTGCCCAACCCCAGTGCCAGG + Intergenic
1169623675 20:7538722-7538744 CCCTGCCCAAAGCTAGTGTCTGG + Intergenic
1172300802 20:33848703-33848725 GTCTGCCCAAGGCCATGGCCTGG - Intronic
1172771691 20:37385943-37385965 CTCAGCCCAAAGACACAGTCAGG - Intronic
1173672696 20:44809696-44809718 CCCTGCCCAAGACCCCTGCCCGG - Intronic
1175960111 20:62631589-62631611 CTTTGCCCACTGCCACTGCAGGG - Intergenic
1176130399 20:63494418-63494440 CCCAGCCCAAAGCCCCTGCACGG + Intronic
1178390400 21:32193141-32193163 CTGTCCCCTAAGCCACTACCAGG + Intergenic
1178790692 21:35697347-35697369 CCATGCCCAACGCCACTCCCTGG + Intronic
1181746280 22:24956947-24956969 CCATGCCCAAGGCCACAGCCAGG - Intronic
1183115060 22:35685480-35685502 CTCTGCCCAAAGCACCAGCATGG + Intergenic
1183296785 22:37034378-37034400 CTCTGCCCACACTCACGGCCAGG - Intergenic
1183686861 22:39366105-39366127 CTCTGGCCTCAGCCTCTGCCTGG + Intronic
1184033499 22:41908111-41908133 CACTGCCCACAGCCTCAGCCTGG + Intergenic
1184102574 22:42348525-42348547 GGCTGCCCAAAGCCAGTGGCTGG - Intergenic
1184277442 22:43418146-43418168 CTCTGATCAAAGCCAGTGCCAGG - Intronic
1184672681 22:46023641-46023663 CTCTGCCCAAGGCCCCTCCCTGG + Intergenic
1184839176 22:47042619-47042641 CTCTGCCCCATGCCCCTGGCTGG - Intronic
1185042164 22:48510624-48510646 CTCTGCTCAATGACACAGCCAGG - Intronic
1185266996 22:49909607-49909629 CACTGCCCAGAACCACCGCCTGG + Intronic
950105330 3:10384906-10384928 TTCTTCCCAAAGCCAGGGCCAGG + Intronic
950138568 3:10600155-10600177 CTCTGCCCTGAGCCCCTGCTGGG + Intronic
950173598 3:10856136-10856158 CTCTTCCCTTAGCCACCGCCAGG - Intronic
950528870 3:13540803-13540825 CTCAGCCCAGAGCCTGTGCCTGG - Intergenic
950581278 3:13863890-13863912 CTCTCCCCAAGGTGACTGCCTGG - Intronic
951524941 3:23644519-23644541 CTATGTCCAAACCCACTACCAGG - Intergenic
951659818 3:25050233-25050255 CTCTTTCCACAGCCACAGCCTGG - Intergenic
953135189 3:40175857-40175879 CCCTGGCCAAAGCCACTGTATGG + Intronic
953184034 3:40621523-40621545 CTCTGCCTAAGTCCACTGCGAGG + Intergenic
953201743 3:40783980-40784002 CTCTACCCACAGACCCTGCCTGG + Intergenic
954449750 3:50565459-50565481 CTCTCACCAAGGCCACAGCCAGG + Exonic
954793301 3:53148353-53148375 AGCTGCCCAAAGGCACTGTCTGG - Intergenic
959574832 3:107923678-107923700 ATCTGTCCATACCCACTGCCTGG + Intergenic
960395383 3:117131022-117131044 ATCTCCCCAAATCCACTGGCAGG + Intronic
961445153 3:126977001-126977023 TTCTGACCAAGGCCACAGCCAGG - Intergenic
961817375 3:129558162-129558184 CTGTGTTCAAAGCCAGTGCCAGG + Intronic
964335382 3:155649072-155649094 CTGTCCCCCAAGCCACAGCCAGG - Intronic
964769508 3:160209753-160209775 ATCTGCCTAAAGCCAGTGGCAGG - Intergenic
964830890 3:160883572-160883594 TTCTGCCCTAATTCACTGCCTGG - Intronic
965602208 3:170466711-170466733 TTCTGCCCAGAGCCCCTGCTTGG + Exonic
965798569 3:172467505-172467527 GTCTGCCCCTGGCCACTGCCTGG + Intergenic
966200929 3:177359212-177359234 CTCTGCCCCACCCCACTGCGAGG - Intergenic
966818987 3:183910309-183910331 CTGTGCACAAAGCCACCACCAGG - Intergenic
966930645 3:184673409-184673431 CTCTGGCAAAAGCCGCTCCCTGG + Intronic
968463990 4:740873-740895 GGCTGCCCAAAGCCACCGGCAGG - Intronic
968642676 4:1722179-1722201 CTCTGCCCAGAGCCCCTCCCGGG + Intronic
968961123 4:3744193-3744215 CTCTGCCCCAGGCACCTGCCCGG - Intergenic
969524587 4:7697722-7697744 CTGTGTCCACAGCCCCTGCCAGG - Intronic
969858100 4:10015986-10016008 ATCTGCCCAGATCCACGGCCTGG - Intronic
970718537 4:18957826-18957848 ATCTGCCAAAAGCCATGGCCTGG + Intergenic
972121587 4:35710557-35710579 CCCTTCCCAAGGCCGCTGCCTGG - Intergenic
973635956 4:52862246-52862268 CTCTCCCCACAGCCAATCCCGGG - Intergenic
974779155 4:66528964-66528986 CTCTGCCCTACACCTCTGCCTGG - Intergenic
979009206 4:115345403-115345425 CACTGAGCAAAGCCACGGCCAGG - Intergenic
980253662 4:130349556-130349578 AGCTGCCCTAAGCCACTCCCCGG + Intergenic
981300218 4:143178516-143178538 CCCTTCCAACAGCCACTGCCAGG - Intergenic
981722235 4:147813299-147813321 CTCTGCCCACAGCCCCTGCTGGG + Intronic
983998980 4:174217789-174217811 CTCTGGCCACAGCCTCTGCTGGG - Intergenic
984708154 4:182862820-182862842 CTCTGCCCACCTCCTCTGCCAGG + Intergenic
984856304 4:184198984-184199006 CTCTTCCCAGAGCCCCTGCAAGG - Intronic
984856638 4:184201133-184201155 CTCTGCCCCAGGTCTCTGCCTGG + Intronic
985019426 4:185671640-185671662 CTCTGCACAAAGCCAGTAGCAGG + Intronic
985773132 5:1825372-1825394 TTCTGCCCAGAGCCCCTCCCAGG - Intergenic
985843672 5:2328902-2328924 CTCTGCCCACAGTGACTGTCGGG - Intergenic
989999694 5:50878668-50878690 CTATCCCCAAAGCCAGAGCCAGG + Intergenic
994514814 5:100757773-100757795 CGCAGCTCAAAGCTACTGCCTGG - Intergenic
994725226 5:103427511-103427533 CCCTGCCCAAGGTCACAGCCGGG + Intergenic
997235362 5:132269316-132269338 CTCCCACCAAAGCCTCTGCCCGG + Intronic
997602594 5:135150561-135150583 CTGTGCCCATGGCCACAGCCAGG - Intronic
999279889 5:150358060-150358082 TTCTGGCCCAACCCACTGCCCGG - Intronic
1002543116 5:179919490-179919512 CTGTGCCCAGAGACACTGCTGGG + Intronic
1004134183 6:12950714-12950736 CTCTGCCCTAGGCCCCTGACAGG + Intronic
1004318024 6:14608563-14608585 CACAGCCCAGGGCCACTGCCTGG + Intergenic
1005816973 6:29561351-29561373 CCCTGCCCAAAGCCAGGGCCAGG + Intronic
1006162922 6:32048477-32048499 CTCCGCTCACAGGCACTGCCTGG + Intronic
1006304947 6:33213294-33213316 CTCTGCTCTCAGCCGCTGCCTGG - Intergenic
1006799930 6:36753299-36753321 ATGTGCCCAAGGACACTGCCAGG + Intronic
1007462469 6:42028445-42028467 GTCTGCCCATCGCCTCTGCCGGG + Intronic
1007724276 6:43905450-43905472 CTCTGCCCCTAGCCCCTGGCTGG + Intergenic
1015386014 6:132624382-132624404 CTCTGCCTACGGCCACTGCTTGG + Intergenic
1017777161 6:157689322-157689344 CTCTGTCCAAAGCCCCAGACAGG + Intergenic
1017818671 6:158033191-158033213 CCTTTCCCAAAGCCACTACCAGG - Intronic
1018702262 6:166436537-166436559 TTCTGCCCACAGCCCCTGTCAGG - Intronic
1018868366 6:167762470-167762492 GTCAGCACACAGCCACTGCCAGG + Intergenic
1019346867 7:535390-535412 CTCTGCCCAACACCTCTGCATGG + Intergenic
1022639898 7:32172217-32172239 CTTTGCACAAAGACACTGTCAGG + Intronic
1023877283 7:44293928-44293950 CACTGCCCAGACCCACTGCCAGG + Intronic
1023881792 7:44325119-44325141 CTCTGCCCAGCGCGGCTGCCGGG - Intronic
1026931029 7:74223062-74223084 CTCTCCCTAGAGCCACTGCCGGG - Intronic
1026962260 7:74416516-74416538 CTCTGCCCAGGGCCACAGGCTGG - Intergenic
1027544154 7:79505149-79505171 CTTTGCCCTGGGCCACTGCCAGG + Intergenic
1032097970 7:128948933-128948955 CTTGGCCCAAATCCACTTCCAGG - Intronic
1033362805 7:140649981-140650003 CCTTGCCCAAGGCCACTGGCAGG + Intronic
1034284058 7:149873253-149873275 CTAATCCCAAAGCCTCTGCCTGG + Exonic
1035023482 7:155812025-155812047 CTCTTCCCGAACCCCCTGCCCGG + Exonic
1035087257 7:156271182-156271204 CTCTGCCCTCTGCCAGTGCCAGG - Intergenic
1037876376 8:22550953-22550975 CTCTGCCCCAAGCCTCTGTATGG - Intronic
1038938102 8:32274982-32275004 CTCTTCCCAAATCCTCTGCTTGG + Intronic
1039550727 8:38441023-38441045 CACTAGCCAAAGCCACAGCCAGG + Intronic
1039665460 8:39522527-39522549 CTCTGCCCAAGGACACTTCAGGG + Intergenic
1039793497 8:40893605-40893627 CTCTGCCCAATCCCACTAGCAGG + Intronic
1042021139 8:64372150-64372172 CTCCACCCAAGGCCACTGCTAGG - Intergenic
1042269532 8:66941249-66941271 TTCTGCCCAGAGCCACACCCTGG - Intergenic
1042727706 8:71894994-71895016 CTCTGCTCAAAGTATCTGCCTGG - Intronic
1044109115 8:88249693-88249715 TTCTCCCTAAAGCCACTGTCTGG - Intronic
1047229033 8:122980271-122980293 CAGTGGCCAAAGCCCCTGCCAGG + Intergenic
1048686030 8:136906475-136906497 CTCTGCCCTCTGCCAGTGCCAGG - Intergenic
1048850667 8:138642390-138642412 CTCTGCCCAACGCAACTGCCTGG + Intronic
1048915863 8:139182178-139182200 CTCTGCCCCAAACTTCTGCCTGG - Intergenic
1049081546 8:140447002-140447024 CACGGCCCACAGCCACAGCCGGG + Intronic
1049746506 8:144265414-144265436 TTCTGCCTAAGGCCCCTGCCAGG - Intronic
1049798417 8:144506800-144506822 CGCTGCCCAAAGCCGCTCCCTGG - Exonic
1053286037 9:36850113-36850135 TTCTGCCCAGCCCCACTGCCGGG - Intronic
1054920457 9:70537762-70537784 CCCTGCCCCAAGCCACAGCTAGG - Intronic
1056576130 9:87857378-87857400 CTCTGCCCAATCCCACCGTCTGG - Intergenic
1057268139 9:93632144-93632166 CTCTGCCCAAACTCCCTGCAGGG - Intronic
1058528798 9:105885824-105885846 CTCTTCCCTGGGCCACTGCCTGG + Intergenic
1058531493 9:105910042-105910064 TTCTGACTAAAGCCACTGCTGGG + Intergenic
1059809489 9:117839873-117839895 CTCTGTTAAAAGCCACTGGCAGG - Intergenic
1059959164 9:119548377-119548399 CTTTGCCCATGACCACTGCCTGG + Intergenic
1061465874 9:130779171-130779193 CTTTGGCCTAAGCCACTGCCAGG + Intronic
1062346488 9:136117638-136117660 ACCTGCCCAAAGTCACTGCTAGG - Intronic
1062598774 9:137310916-137310938 CTCAACCCAAAGCCCCTGCATGG - Intronic
1062674382 9:137731868-137731890 CTCTGCACAGAGCCAGAGCCTGG - Intronic
1062723288 9:138056385-138056407 CTCTGACACAAGCCACTGCGTGG - Intronic
1185464128 X:345292-345314 CTCTGCCCGAGGCCTCTGCCTGG - Intronic
1185675452 X:1845523-1845545 CACTTCCAAAACCCACTGCCTGG - Intergenic
1189761210 X:44323474-44323496 CTCTGCCCAAATTCAGTGCATGG - Intronic
1197104601 X:122699275-122699297 CTTTACCCAGAGCCAGTGCCTGG - Intergenic
1197716216 X:129707924-129707946 TTCTGCCCAAAGGCACTTTCTGG + Intergenic
1198046996 X:132913242-132913264 CTCTGCCCTCCGCCAGTGCCAGG + Intronic
1198442166 X:136673716-136673738 GCATGCCCAAAGCCACAGCCAGG + Intronic
1198579338 X:138046553-138046575 CTTGGCCCAAAACCACTGGCTGG - Intergenic
1198699563 X:139382528-139382550 CTACGCCCACAGCCACAGCCGGG + Intergenic
1200258738 X:154600246-154600268 CACAGGCCAATGCCACTGCCAGG - Intergenic
1200326177 X:155242069-155242091 CTCTGCCTAAAGCCACCCTCTGG - Intergenic
1201291184 Y:12421571-12421593 CTCTGCCCAAAGCCGGCGCTGGG + Intergenic