ID: 1137275968

View in Genome Browser
Species Human (GRCh38)
Location 16:46933704-46933726
Sequence GACAGCACTGAGAAGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137275968_1137275973 12 Left 1137275968 16:46933704-46933726 CCTGACCACTTCTCAGTGCTGTC No data
Right 1137275973 16:46933739-46933761 GTCACTCTGCCCCCCAAGTGGGG No data
1137275968_1137275979 30 Left 1137275968 16:46933704-46933726 CCTGACCACTTCTCAGTGCTGTC No data
Right 1137275979 16:46933757-46933779 TGGGGAGAACTCCAAGAAGAAGG No data
1137275968_1137275971 10 Left 1137275968 16:46933704-46933726 CCTGACCACTTCTCAGTGCTGTC No data
Right 1137275971 16:46933737-46933759 CTGTCACTCTGCCCCCCAAGTGG No data
1137275968_1137275972 11 Left 1137275968 16:46933704-46933726 CCTGACCACTTCTCAGTGCTGTC No data
Right 1137275972 16:46933738-46933760 TGTCACTCTGCCCCCCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137275968 Original CRISPR GACAGCACTGAGAAGTGGTC AGG (reversed) Intergenic
No off target data available for this crispr