ID: 1137282746

View in Genome Browser
Species Human (GRCh38)
Location 16:46992343-46992365
Sequence GAGCCCTGAATAGCAGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137282746_1137282758 24 Left 1137282746 16:46992343-46992365 CCTGCCGCTGCTATTCAGGGCTC No data
Right 1137282758 16:46992390-46992412 GATCAGAGCAGGTGCCGAAAAGG No data
1137282746_1137282759 29 Left 1137282746 16:46992343-46992365 CCTGCCGCTGCTATTCAGGGCTC No data
Right 1137282759 16:46992395-46992417 GAGCAGGTGCCGAAAAGGAAAGG No data
1137282746_1137282760 30 Left 1137282746 16:46992343-46992365 CCTGCCGCTGCTATTCAGGGCTC No data
Right 1137282760 16:46992396-46992418 AGCAGGTGCCGAAAAGGAAAGGG No data
1137282746_1137282754 13 Left 1137282746 16:46992343-46992365 CCTGCCGCTGCTATTCAGGGCTC No data
Right 1137282754 16:46992379-46992401 CCCAACTCCCTGATCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137282746 Original CRISPR GAGCCCTGAATAGCAGCGGC AGG (reversed) Intergenic
No off target data available for this crispr