ID: 1137282805

View in Genome Browser
Species Human (GRCh38)
Location 16:46992557-46992579
Sequence CCACCAACGTGGAAGTGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137282792_1137282805 4 Left 1137282792 16:46992530-46992552 CCGCAGCTACACCCTGGGAGCTC No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282793_1137282805 -7 Left 1137282793 16:46992541-46992563 CCCTGGGAGCTCCCGCCCACCAA No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282786_1137282805 29 Left 1137282786 16:46992505-46992527 CCCGGTCCTGCAGCTGGGACGGT No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282787_1137282805 28 Left 1137282787 16:46992506-46992528 CCGGTCCTGCAGCTGGGACGGTG No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282789_1137282805 23 Left 1137282789 16:46992511-46992533 CCTGCAGCTGGGACGGTGGCCGC No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282784_1137282805 30 Left 1137282784 16:46992504-46992526 CCCCGGTCCTGCAGCTGGGACGG No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data
1137282794_1137282805 -8 Left 1137282794 16:46992542-46992564 CCTGGGAGCTCCCGCCCACCAAC No data
Right 1137282805 16:46992557-46992579 CCACCAACGTGGAAGTGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137282805 Original CRISPR CCACCAACGTGGAAGTGGGG GGG Intergenic
No off target data available for this crispr