ID: 1137286549

View in Genome Browser
Species Human (GRCh38)
Location 16:47020879-47020901
Sequence TCAGGAGTTCAAGACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 664798
Summary {0: 50001, 1: 120441, 2: 170670, 3: 194372, 4: 129314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137286549_1137286551 -2 Left 1137286549 16:47020879-47020901 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1137286551 16:47020900-47020922 GACCTCATGATCCATCGCCTTGG No data
1137286549_1137286554 14 Left 1137286549 16:47020879-47020901 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089
1137286549_1137286556 15 Left 1137286549 16:47020879-47020901 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137286549 Original CRISPR TCAGGAGTTCAAGACCAGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr