ID: 1137286550

View in Genome Browser
Species Human (GRCh38)
Location 16:47020897-47020919
Sequence AGGCGATGGATCATGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137286550_1137286554 -4 Left 1137286550 16:47020897-47020919 CCTGACCTCATGATCCATCGCCT No data
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089
1137286550_1137286556 -3 Left 1137286550 16:47020897-47020919 CCTGACCTCATGATCCATCGCCT No data
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137286550 Original CRISPR AGGCGATGGATCATGAGGTC AGG (reversed) Intergenic
No off target data available for this crispr