ID: 1137286552

View in Genome Browser
Species Human (GRCh38)
Location 16:47020902-47020924
Sequence AGCCAAGGCGATGGATCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137286552_1137286556 -8 Left 1137286552 16:47020902-47020924 CCTCATGATCCATCGCCTTGGCT No data
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895
1137286552_1137286554 -9 Left 1137286552 16:47020902-47020924 CCTCATGATCCATCGCCTTGGCT No data
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137286552 Original CRISPR AGCCAAGGCGATGGATCATG AGG (reversed) Intergenic
No off target data available for this crispr