ID: 1137286554

View in Genome Browser
Species Human (GRCh38)
Location 16:47020916-47020938
Sequence GCCTTGGCTTCCCAAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 628177
Summary {0: 2598, 1: 60586, 2: 173311, 3: 219593, 4: 172089}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137286550_1137286554 -4 Left 1137286550 16:47020897-47020919 CCTGACCTCATGATCCATCGCCT No data
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089
1137286552_1137286554 -9 Left 1137286552 16:47020902-47020924 CCTCATGATCCATCGCCTTGGCT No data
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089
1137286549_1137286554 14 Left 1137286549 16:47020879-47020901 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1137286554 16:47020916-47020938 GCCTTGGCTTCCCAAAGTGCTGG 0: 2598
1: 60586
2: 173311
3: 219593
4: 172089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137286554 Original CRISPR GCCTTGGCTTCCCAAAGTGC TGG Intergenic
Too many off-targets to display for this crispr