ID: 1137286556

View in Genome Browser
Species Human (GRCh38)
Location 16:47020917-47020939
Sequence CCTTGGCTTCCCAAAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 698370
Summary {0: 4470, 1: 94554, 2: 217476, 3: 235975, 4: 145895}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137286549_1137286556 15 Left 1137286549 16:47020879-47020901 CCAGGCTGGTCTTGAACTCCTGA 0: 50001
1: 120441
2: 170670
3: 194372
4: 129314
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895
1137286550_1137286556 -3 Left 1137286550 16:47020897-47020919 CCTGACCTCATGATCCATCGCCT No data
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895
1137286552_1137286556 -8 Left 1137286552 16:47020902-47020924 CCTCATGATCCATCGCCTTGGCT No data
Right 1137286556 16:47020917-47020939 CCTTGGCTTCCCAAAGTGCTGGG 0: 4470
1: 94554
2: 217476
3: 235975
4: 145895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137286556 Original CRISPR CCTTGGCTTCCCAAAGTGCT GGG Intergenic
Too many off-targets to display for this crispr