ID: 1137288780

View in Genome Browser
Species Human (GRCh38)
Location 16:47037745-47037767
Sequence GGGCTCCGGAGGCGGCGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137288760_1137288780 27 Left 1137288760 16:47037695-47037717 CCCGTTCCACGGTGGGAGGCGTC No data
Right 1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG No data
1137288772_1137288780 -2 Left 1137288772 16:47037724-47037746 CCGGGAACACAGGGAGGCGGGGG No data
Right 1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG No data
1137288762_1137288780 21 Left 1137288762 16:47037701-47037723 CCACGGTGGGAGGCGTCACGCGG No data
Right 1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG No data
1137288761_1137288780 26 Left 1137288761 16:47037696-47037718 CCGTTCCACGGTGGGAGGCGTCA No data
Right 1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG No data
1137288759_1137288780 28 Left 1137288759 16:47037694-47037716 CCCCGTTCCACGGTGGGAGGCGT No data
Right 1137288780 16:47037745-47037767 GGGCTCCGGAGGCGGCGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137288780 Original CRISPR GGGCTCCGGAGGCGGCGGCT GGG Intergenic
No off target data available for this crispr