ID: 1137289216

View in Genome Browser
Species Human (GRCh38)
Location 16:47040344-47040366
Sequence GTGACCTCCTCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137289208_1137289216 17 Left 1137289208 16:47040304-47040326 CCTTCACAATAGCACCCAAGGTA No data
Right 1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG No data
1137289213_1137289216 2 Left 1137289213 16:47040319-47040341 CCAAGGTAGGTACTCAGGCAGGA No data
Right 1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG No data
1137289211_1137289216 3 Left 1137289211 16:47040318-47040340 CCCAAGGTAGGTACTCAGGCAGG No data
Right 1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137289216 Original CRISPR GTGACCTCCTCAAGATCACA TGG Intergenic
No off target data available for this crispr