ID: 1137291626

View in Genome Browser
Species Human (GRCh38)
Location 16:47055542-47055564
Sequence GGCCTCCCGCTTCACAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137291626_1137291632 1 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291632 16:47055566-47055588 AGGTCTGCAGCCACAGTTTGGGG No data
1137291626_1137291635 23 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291635 16:47055588-47055610 GGACTGCAGCTGCACCCGCAAGG No data
1137291626_1137291636 24 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291636 16:47055589-47055611 GACTGCAGCTGCACCCGCAAGGG No data
1137291626_1137291633 2 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291633 16:47055567-47055589 GGTCTGCAGCCACAGTTTGGGGG No data
1137291626_1137291631 0 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291631 16:47055565-47055587 CAGGTCTGCAGCCACAGTTTGGG No data
1137291626_1137291630 -1 Left 1137291626 16:47055542-47055564 CCTGCTCTGTGAAGCGGGAGGCC No data
Right 1137291630 16:47055564-47055586 CCAGGTCTGCAGCCACAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137291626 Original CRISPR GGCCTCCCGCTTCACAGAGC AGG (reversed) Intergenic
No off target data available for this crispr