ID: 1137295131

View in Genome Browser
Species Human (GRCh38)
Location 16:47085033-47085055
Sequence CTGCTGTCTTAGAGGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137295129_1137295131 -7 Left 1137295129 16:47085017-47085039 CCAAAAAGGTTGGGGACTGCTGT 0: 93
1: 499
2: 1047
3: 1409
4: 1348
Right 1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 221
1137295127_1137295131 1 Left 1137295127 16:47085009-47085031 CCTTGGTACCAAAAAGGTTGGGG 0: 69
1: 1010
2: 1667
3: 1324
4: 849
Right 1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 221
1137295122_1137295131 14 Left 1137295122 16:47084996-47085018 CCACGAAACCAGTCCTTGGTACC 0: 1
1: 20
2: 203
3: 870
4: 1329
Right 1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 221
1137295124_1137295131 6 Left 1137295124 16:47085004-47085026 CCAGTCCTTGGTACCAAAAAGGT 0: 3
1: 67
2: 739
3: 1057
4: 890
Right 1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137295131 Original CRISPR CTGCTGTCTTAGAGGATAAA AGG Intronic
905793810 1:40804094-40804116 CTGCTGACTCAGAGGACAGAAGG + Intronic
906819628 1:48915747-48915769 CTGCTGTACTAAAGGATAGAAGG + Intronic
910766784 1:90790077-90790099 CTGCTGGCTTTGAGGATGGAAGG + Intergenic
910973749 1:92883977-92883999 CTTCTGCCTTAGAGGAGAACTGG + Intronic
911316216 1:96359571-96359593 CTGCTCTCTCAGAAGATACAAGG + Intergenic
913574487 1:120157190-120157212 ATGCTGTCAAAGAGGAAAAAAGG + Exonic
914295756 1:146321994-146322016 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914556795 1:148772792-148772814 ATGCTGTCAAAGAGGAAAAAAGG + Intergenic
914616039 1:149357438-149357460 ATGCTGTCAAAGAGGAAAAAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
918831242 1:189401085-189401107 CACCTGTCTTAGAGTGTAAAGGG + Intergenic
919011025 1:191963327-191963349 TTGTTCTCTTAGAGCATAAATGG - Intergenic
921997022 1:221431509-221431531 CTGCTGTTTTAGAGGACCCATGG - Intergenic
1062956894 10:1546470-1546492 CTCCTGACTTTGAGGAGAAATGG + Intronic
1064094048 10:12409367-12409389 CGGCTGTGATAGAGGATAGAGGG + Intronic
1064332999 10:14411285-14411307 CTGCTTTCTTGGAAGAAAAAAGG - Intronic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1064688686 10:17891622-17891644 CTGCTGACGTAGTGGATAAAGGG + Intronic
1064886010 10:20113420-20113442 CTGATGGCTTATTGGATAAAGGG - Intronic
1066485314 10:35837633-35837655 GTCCTGTCTAAGAGGACAAAGGG + Intergenic
1070762035 10:79029909-79029931 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
1070864866 10:79702246-79702268 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1070878655 10:79840374-79840396 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1071598590 10:86945105-86945127 CTGCTGTATCACAGGAAAAAGGG + Intronic
1071631760 10:87224463-87224485 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1071645214 10:87356684-87356706 GTTCTGTCTCAGAGGACAAAAGG + Intergenic
1073140189 10:101242177-101242199 CACCTGTATTAGAGAATAAAAGG - Intergenic
1076045500 10:127291317-127291339 CTGCCTGCTTTGAGGATAAAGGG - Intronic
1079933154 11:26590066-26590088 CTATTCTCTTAGAGGGTAAAGGG - Intronic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1083461010 11:62811885-62811907 CTGCTGGGTCTGAGGATAAAAGG - Intronic
1083988363 11:66231714-66231736 CTGCTGTCTGAGGGAACAAAAGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089001910 11:115059196-115059218 CTGGTGTCTTAGAGGAGAGGAGG + Intergenic
1089281229 11:117376009-117376031 CTGCTGAATGAGTGGATAAATGG - Intronic
1089892030 11:121891129-121891151 CGGCTGGCTTACAGGATATATGG - Intergenic
1092759203 12:11794096-11794118 CTGCTTTCTTAGAGGCACAATGG + Intronic
1095155269 12:38845285-38845307 CTGGTGTGTTAGAGAACAAAAGG - Intronic
1095717972 12:45369262-45369284 ATGCTGACTCAGAGGCTAAAGGG + Intronic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1096587565 12:52632743-52632765 CTGCTGACTTGGAGGTTAACTGG + Intergenic
1096737319 12:53665872-53665894 AGACTGTCTTAGAGAATAAAGGG - Intronic
1097551909 12:61083341-61083363 CTAAAGTCTTAGAGGATAAGAGG + Intergenic
1097610568 12:61814830-61814852 CTGCTGGCTTTGAAGATGAAGGG + Intronic
1098228423 12:68348463-68348485 CTGCTGTTTTGGGGGATAATTGG - Intergenic
1099508930 12:83509634-83509656 CTGTTGACTTAGAGGAAAAGAGG - Intergenic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101298755 12:103455681-103455703 CTGCTCTCTAAGAAGAGAAAAGG - Intronic
1104330586 12:127840708-127840730 CTGAAGTCTTATAGAATAAATGG + Intergenic
1105468398 13:20668849-20668871 CTGCCTGCTTAGAGAATAAAAGG - Intronic
1105697348 13:22901540-22901562 CTCCTGTCTCAAAGTATAAAGGG + Intergenic
1105773732 13:23637563-23637585 CTGCTGGCATAGAGGATAGCAGG + Intronic
1108700582 13:52940806-52940828 CTTCTGTCTCAAATGATAAATGG + Intergenic
1108993091 13:56688972-56688994 CTGCTCTATTAGAGTAGAAAGGG + Intergenic
1109885162 13:68532450-68532472 CTGCTGTCTTCAATGTTAAAAGG - Intergenic
1111184327 13:84711633-84711655 TTGTTCTTTTAGAGGATAAATGG + Intergenic
1113145838 13:107206249-107206271 ATTCTGTCTTAGGAGATAAAAGG - Intronic
1113178014 13:107588593-107588615 CTGCTGTCTGTGAGTGTAAAAGG + Intronic
1114791195 14:25660300-25660322 CTGCAGTCTCAGAGGATTCAAGG + Intergenic
1115287071 14:31726307-31726329 TAGCTGTCTTAAAGTATAAAGGG + Intronic
1117284470 14:54273479-54273501 CTGCTGTCTGGCAGGAGAAATGG - Intergenic
1117410188 14:55443392-55443414 TTGCTGGCTTTGAAGATAAATGG + Intronic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119877309 14:78071854-78071876 CTGGGGTATTAGAGGATATATGG - Intergenic
1120280846 14:82436097-82436119 CGGCTGTCTGATAGAATAAAAGG + Intergenic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1126427589 15:48546310-48546332 CTGCTGTCATAGAGAATAATTGG + Intronic
1126522959 15:49617969-49617991 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1130757761 15:86783957-86783979 CTGCTGGTTTAGAGGAGGAATGG + Intronic
1130765880 15:86870744-86870766 CTGATTTCTTTCAGGATAAACGG + Intronic
1130865646 15:87931153-87931175 CTACTGTCATACATGATAAAAGG - Intronic
1132657929 16:1049027-1049049 CTGCTGTCTTACGAGACAAAGGG + Intergenic
1133657850 16:7883703-7883725 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137325552 16:47431544-47431566 CTGCTGGCTTAGTGGGTACAGGG + Intronic
1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG + Intergenic
1139310859 16:66026972-66026994 GTGATGTCTTAGATGATGAAAGG - Intergenic
1141804205 16:86332020-86332042 CTGCTGACTTTGAAGATTAAGGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143809246 17:9457368-9457390 TTGCTGGCTTAGAAGATAGAAGG - Intronic
1143929900 17:10411484-10411506 ATGCAATCTTAGAGGAGAAAAGG - Intronic
1145724602 17:27106865-27106887 CTGCTGTTTTAGACCATATAGGG + Intergenic
1146694266 17:34896870-34896892 CTGCTGAATTAGAGGAAGAAAGG - Intergenic
1146749084 17:35361309-35361331 CTGCTGGCATAGAGCATAATGGG + Intronic
1148109897 17:45138414-45138436 CTGCTTGCTCAGAGGAAAAAAGG - Intronic
1149018203 17:51933195-51933217 ATGCTATCTTAGATGGTAAAGGG + Intronic
1150649523 17:67000794-67000816 CTGCTGACTTGGAGCAGAAAGGG - Intronic
1152977638 18:238260-238282 CTGCTGAGTTATAAGATAAAAGG + Intronic
1154248888 18:12726191-12726213 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1154932649 18:21016408-21016430 ATCCTGTATTAAAGGATAAATGG - Intronic
1155281835 18:24248179-24248201 CTGCTATCTCAGAGCATATAAGG + Intronic
1158040834 18:53091122-53091144 CGGCTATCTTAGAGAATACATGG + Intronic
1159529887 18:69642047-69642069 CTGCTGAGTTAGAGTGTAAATGG - Intronic
1160207203 18:76844406-76844428 CTGTTGTCTTAGAGGAATAGGGG + Intronic
1161232465 19:3181186-3181208 CTGCTGTGTTGGTGGGTAAATGG - Intergenic
1164785075 19:30924113-30924135 CTTCTGTCTTAGAGGCTGCACGG + Intergenic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
925725526 2:6867096-6867118 GTACTGTCTTAGAGAAGAAAAGG - Intronic
926620195 2:15040458-15040480 TTGCTGTCTTAGAGAACACAAGG - Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
927227427 2:20782635-20782657 CTGATCTCTTAGATAATAAAAGG - Intronic
927826407 2:26312778-26312800 GTGGTGTCTGAGAGGAGAAATGG + Intronic
928601153 2:32904752-32904774 TTTCTGTTATAGAGGATAAAGGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
936804800 2:116317942-116317964 CTGCTGTGGTAGCAGATAAATGG + Intergenic
937470609 2:122171025-122171047 CTGCTGGCTTTGAGGATGGAGGG + Intergenic
939186662 2:138869131-138869153 CTGCTTTCATAGATGATTAAAGG + Intergenic
939223545 2:139336098-139336120 CTACTGTGTTACAGTATAAAAGG + Intergenic
939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG + Intergenic
944192340 2:197016545-197016567 CTGCTGACTTACAGTTTAAAGGG + Intronic
944347185 2:198683650-198683672 CTGCTGTTATAGATCATAAATGG - Intergenic
944717036 2:202384929-202384951 CTACTGTCTTGAAGGAGAAAGGG - Intronic
944960866 2:204871893-204871915 ATGCTGTCTTTAAGAATAAAGGG - Intronic
947457717 2:230270806-230270828 CTGCTATCTTACATGACAAAAGG + Intronic
947940004 2:234045358-234045380 CTGCTAACTGAGAGGATAGATGG - Intergenic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948394877 2:237637968-237637990 CTGCTGTCTTAGGGAAGACAGGG - Intronic
1169844460 20:9974555-9974577 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
1173684680 20:44914682-44914704 TTCCTGTCTTTGAGGATCAAAGG + Intronic
1174142897 20:48429024-48429046 CTGCTGGCTTTGAGGATGGAAGG - Intergenic
1174518354 20:51110740-51110762 TTGCTGTCTGATTGGATAAAAGG - Intergenic
1174846310 20:53946446-53946468 ATACTGTCTTATAGTATAAAAGG - Intronic
1175337869 20:58207704-58207726 CTCCTGGCTTTGAGGAGAAATGG - Intergenic
1180639802 22:17289053-17289075 CTGCTATCTCAGAGGAAGAAGGG - Intergenic
1184931933 22:47687811-47687833 CTGCTGGCTTTGAGGATGAAGGG - Intergenic
950550514 3:13663374-13663396 CTGCTGGCTTTGAGGATGGAGGG - Intergenic
950638002 3:14329634-14329656 CTGCTGACTCAGAGGAACAAGGG + Intergenic
951625756 3:24661668-24661690 TTCCTGTCTTAGGAGATAAATGG - Intergenic
952268259 3:31807417-31807439 ATGCTGTGTTGGAGGATATATGG + Intronic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953776352 3:45820659-45820681 CTTGTTTCTGAGAGGATAAATGG + Intergenic
955874450 3:63475253-63475275 CTACTGTCTTAGATGATCTACGG - Intronic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
958965441 3:100552908-100552930 CTGTTGTCTTAGAGGGTTACTGG - Intronic
959980217 3:112507698-112507720 ATGCTGGCTTTGAAGATAAAGGG - Intergenic
960600075 3:119448333-119448355 CTGCTCTCTTAGAGGTTATGGGG - Intronic
961240150 3:125403633-125403655 CTGCCTTCTTTGAGGATAAGAGG - Intergenic
962891006 3:139673045-139673067 CTGCTGTCTGAGAGGAAAGAAGG - Intronic
962960897 3:140310098-140310120 CTGCAGTCTTAGAGGAGAAAGGG - Intronic
964367969 3:155969923-155969945 CTGCTGGCTTGGAAAATAAAGGG - Intergenic
964653931 3:159045133-159045155 TTGCTGTCTTAGAAGATTAAGGG - Intronic
964716548 3:159728523-159728545 CAGCTGTCTTATGAGATAAAGGG + Intronic
968000596 3:195203441-195203463 CTGCTGTCTTGAAGGATATGTGG - Intronic
971789921 4:31156231-31156253 CTGCTGTATTATAGGATGACAGG - Intergenic
972388001 4:38586451-38586473 CTGCTGACTTTGAGGATGGAAGG - Intergenic
972436933 4:39044419-39044441 CTGTTGTCTCAGAGCTTAAAGGG - Intergenic
972473322 4:39428023-39428045 CAGCTCTATTAGGGGATAAATGG - Intronic
973716947 4:53686189-53686211 CTCCTGTCTTAGAAGAGGAATGG - Intronic
976663205 4:87561942-87561964 CTGCTGTCATAGAAGTTTAAGGG - Intergenic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
979878295 4:125922008-125922030 CTGCTGGCTGAGAAGCTAAAAGG + Intergenic
981986547 4:150863878-150863900 CTGCTATCTTAGAAAATAATAGG - Intronic
981999933 4:151013245-151013267 CACCTGTGTTAGAGGATAACAGG - Intronic
982084711 4:151822466-151822488 CTGCTGTCTTGGAGCATATGTGG + Intergenic
985089196 4:186346155-186346177 CAGCTGTTTTAGATCATAAAGGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
985437375 4:189943412-189943434 CTACTGTGTTAAAGAATAAATGG - Intronic
986977262 5:13409154-13409176 CTGCTGTCTTAGTGGATTTGGGG - Intergenic
987398413 5:17448343-17448365 CTTCTGTCGGGGAGGATAAAAGG - Intergenic
988139696 5:27219972-27219994 CAGCTGCCTTAGAGATTAAATGG - Intergenic
989209372 5:38844951-38844973 CACCTCTCTTAGAGGATAACAGG - Intergenic
990047073 5:51445921-51445943 GTGCTCTCTTAGAGTAAAAAGGG - Intergenic
990718200 5:58662553-58662575 CTGCTTTCTTAGCTGATAAATGG - Intronic
991453014 5:66772684-66772706 CTGCTGTTTTAGGGTGTAAATGG + Intronic
992077702 5:73206395-73206417 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
993121554 5:83780604-83780626 CTGCTGTCATAGATGTAAAATGG - Intergenic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
998807405 5:145932267-145932289 CTGCCTTCCCAGAGGATAAAAGG + Intergenic
999941071 5:156543744-156543766 CTGCAGTCTTGGAGGATCAAAGG - Intronic
1000366863 5:160499953-160499975 ATGCTGTCGTAGAGGCCAAAAGG + Intergenic
1001988869 5:176099437-176099459 CAGCTGTGGTGGAGGATAAATGG - Intronic
1002227996 5:177738699-177738721 CAGCTGTGGTGGAGGATAAATGG + Intronic
1004061430 6:12201921-12201943 TTGCTGAGTTGGAGGATAAAAGG + Intergenic
1005527585 6:26666410-26666432 CTGCTGTTTTAGGGTATACAGGG - Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007304611 6:40894131-40894153 CAGCTGTCTTAGAGGTGAAGAGG - Intergenic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009730411 6:67596190-67596212 TTGCCGTCTTAGATGATCAATGG - Intergenic
1011189010 6:84711438-84711460 CTGCTTTCTTAGGGAAGAAAAGG + Intronic
1012198833 6:96379607-96379629 CTACCATCTTAGAGTATAAAAGG + Intergenic
1012588782 6:100953583-100953605 CTGCTGTCTAACAGCATCAAAGG - Intergenic
1013659704 6:112282593-112282615 ATGCTGTTTTAGAGGTTAATGGG + Intergenic
1016845550 6:148564875-148564897 CTGCTGGCTTTGAGGTTTAAGGG + Intergenic
1017540748 6:155399977-155399999 CTGCTGACTTTGATGAGAAAAGG + Intronic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1018695642 6:166389260-166389282 CTATTCTCTTAGAGGGTAAAGGG + Intergenic
1018741546 6:166732931-166732953 CTGCTGGCTTAGAGGAAATGAGG + Intronic
1022911125 7:34900364-34900386 CTGTTATCTTACATGATAAAAGG + Intergenic
1023019525 7:35997883-35997905 CTGATTTATTAGAGTATAAATGG + Intergenic
1024834929 7:53505597-53505619 CTCCTGTGTTGGAGAATAAAAGG + Intergenic
1026342775 7:69448335-69448357 ATGCCGTCTCAGAGGAGAAAAGG + Intergenic
1026595230 7:71729168-71729190 CTGCTCCCTTAGAGAATAAGAGG + Intergenic
1026613577 7:71882210-71882232 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1028594032 7:92528740-92528762 CCGCTCTCTTATTGGATAAAAGG + Intergenic
1030377689 7:108772542-108772564 ATGCTTTCTTGGAGGAAAAAAGG - Intergenic
1031550984 7:123111244-123111266 TTGCTGGCTTTGAAGATAAAAGG - Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1033068567 7:138180255-138180277 CTGCTGTCTTTGAAGATGGAAGG + Intergenic
1038436473 8:27540109-27540131 TTCCTGCCTTAGAGGAAAAACGG + Intronic
1040710496 8:50182947-50182969 ATGGTGTCTCTGAGGATAAAGGG - Intronic
1040856700 8:51956066-51956088 TTTCTATCTTAGAGGATATAAGG - Intergenic
1044213778 8:89582943-89582965 CTTCAGTCATAGAGGACAAATGG + Intergenic
1045520527 8:102899173-102899195 ATGCTTACTTAGAGCATAAAAGG + Intronic
1047422164 8:124716232-124716254 CCTCGGTCTCAGAGGATAAATGG + Intronic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1050594153 9:7189059-7189081 CTGCTGTCTGAAAGGTTAAATGG + Intergenic
1051506383 9:17831734-17831756 CTCCTTTCTTATAGGAGAAAGGG - Intergenic
1054854147 9:69879895-69879917 GTTCTGTCTTAGTTGATAAAGGG + Intronic
1055159216 9:73104657-73104679 CTGCTGGCTTCAAAGATAAAGGG + Intergenic
1057053207 9:91941458-91941480 CTGCCATGTTAAAGGATAAAGGG - Intronic
1057170225 9:92958612-92958634 ATGATTTCTTAGAGTATAAAAGG - Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1057958172 9:99428858-99428880 CTGCTGGCTTTGAAGATAGAAGG + Intergenic
1058276872 9:103054028-103054050 CTGAAGCCTGAGAGGATAAAAGG + Intergenic
1060213876 9:121726731-121726753 CTGCTTTGTGAGAGTATAAAAGG + Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186271000 X:7887988-7888010 CTGTTGTCTTTCAGAATAAAAGG - Intergenic
1186792484 X:13012477-13012499 CTGCTGGCTTTGAAGATAGAGGG + Intergenic
1187882453 X:23859838-23859860 CTGCTCTCTTAGGGAAAAAAAGG - Intronic
1188988999 X:36794622-36794644 GTGCTTTCTCAGTGGATAAACGG + Intergenic
1192070877 X:67940182-67940204 CTGCTGTCTTTCTGGATAGAAGG - Intergenic
1194922264 X:99780666-99780688 CTGCTGTATCAGAGGGCAAAAGG - Intergenic
1195054837 X:101134251-101134273 CCCCAGTCTTAGAGGATAAATGG - Intronic
1195317166 X:103690554-103690576 GTGCTGATTTAGAGGATATAAGG + Intergenic
1195638705 X:107149859-107149881 CTGTTGTCTTAGCAGCTAAATGG - Intronic
1196727606 X:118910720-118910742 CTGCTGTCTGAGAAGATACTTGG + Intergenic
1197183075 X:123557537-123557559 CTGCTGGCTTTGAAGATGAAGGG + Intergenic
1197343810 X:125307211-125307233 CTGCTATGTTAAAGGGTAAAAGG + Intergenic
1197700012 X:129592342-129592364 CTGCTGTCTTAGGGAAGAAATGG + Exonic
1197849003 X:130836919-130836941 ATGCTCACCTAGAGGATAAAAGG - Intronic