ID: 1137299458

View in Genome Browser
Species Human (GRCh38)
Location 16:47133720-47133742
Sequence CAGTGTGGTTGGCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137299454_1137299458 10 Left 1137299454 16:47133687-47133709 CCTACAGCAGGTTTTAGGGAACT 0: 1
1: 0
2: 0
3: 14
4: 129
Right 1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG 0: 1
1: 0
2: 2
3: 29
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137299458 Original CRISPR CAGTGTGGTTGGCAAGTGGA AGG Intronic
901401507 1:9018083-9018105 CAGTGTGGTGGGCAAAGGGATGG - Intronic
901928588 1:12582918-12582940 GAGTGGGGTGGGTAAGTGGATGG - Intronic
903561842 1:24233901-24233923 CAGTCATGATGGCAAGTGGAGGG + Intergenic
904659764 1:32075630-32075652 CAGTTTGGGTGGCCAGAGGAGGG - Exonic
905008600 1:34731170-34731192 GAGTGTCGTGGGCAAGGGGAGGG - Intronic
905206251 1:36344342-36344364 AAGTGAGGGTGGCAGGTGGAGGG - Intronic
905228108 1:36493025-36493047 CACTGGGGTGGGCAGGTGGAAGG + Intergenic
906179417 1:43805546-43805568 CACTATGCTTGGCATGTGGAAGG - Intronic
906944028 1:50280267-50280289 CATTTTGTTTGGAAAGTGGAAGG + Intergenic
906948325 1:50314692-50314714 CAGTGTTGGTGGAAAGTGGGGGG - Intergenic
907300276 1:53482635-53482657 CAGTGTGGCTGGCATGCGGGGGG - Intergenic
907727206 1:57030564-57030586 CAGTGTGGTGGACAAGGGCAAGG + Intronic
909056723 1:70829500-70829522 CCATGTGGCTGGCAAGTGTAGGG + Intergenic
910658593 1:89644661-89644683 CTCTGTGGTTGGAAAGTGAAGGG + Intronic
914441578 1:147712133-147712155 CAGTGTGCCTGGCAAATGGGAGG + Intergenic
916751537 1:167727249-167727271 CAGTGTGGATGCAAAGTGGATGG - Intronic
917096525 1:171404096-171404118 CAGTGAAGTTGTCATGTGGAAGG - Intergenic
917707580 1:177649700-177649722 CAGTGTGGTTTGCTAGTAGAAGG - Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920939445 1:210467662-210467684 CATGGTGGATGGGAAGTGGAGGG + Intronic
921412782 1:214853741-214853763 GAGTGTGGGTGGGAAGAGGAGGG + Intergenic
922821695 1:228489042-228489064 CAGTGTGGAAGGCAAGTGGGGGG + Exonic
923265420 1:232309036-232309058 CAGTGTGGTGGGAAAGGGGAGGG - Intergenic
924401027 1:243682259-243682281 TATTGTGGATGGGAAGTGGAGGG - Intronic
1063618945 10:7627137-7627159 CGGGGTGGTGGGCAAGGGGAGGG + Intronic
1063983507 10:11476289-11476311 CATTGTGGTTGGCTGGGGGAAGG + Intronic
1065322008 10:24519048-24519070 CACTTAGGTGGGCAAGTGGATGG - Intronic
1065399810 10:25286258-25286280 CAGAGTGGGAGGCAAGGGGAAGG - Intronic
1065828009 10:29589351-29589373 CAGTGTGGTGGGAATCTGGAGGG + Intronic
1067267777 10:44761430-44761452 CAGTGTGCTTCCCAAGTGGCTGG - Intergenic
1067328858 10:45295388-45295410 GAGGGTGGTGGGCAAGGGGAGGG - Intergenic
1072378629 10:94842202-94842224 CAGTCAGCTTGGCAAGAGGATGG - Intronic
1072715699 10:97751096-97751118 CAGAGTGGCTGGTAAGTGGCAGG + Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074423807 10:113333201-113333223 CAGTGTGGTGGGCAAAAGAATGG + Intergenic
1075393575 10:122111265-122111287 CTGTATGGTTGGCAAAAGGAAGG - Intronic
1075730079 10:124630835-124630857 CAGTCTGGCTGGCATGTGGCAGG - Intronic
1076134470 10:128036074-128036096 CAGGGATGTTGGGAAGTGGACGG + Intronic
1077327808 11:1971264-1971286 CTGTGTGGCTGGAAGGTGGAGGG - Intronic
1080282091 11:30569072-30569094 CAGTTTGGTTGCCAAGATGATGG + Intronic
1082806419 11:57454582-57454604 AGCTGTGGTTGGGAAGTGGAGGG - Intergenic
1083061436 11:59876948-59876970 GAGTGGGGTTAGCAAGAGGAAGG - Intergenic
1083162396 11:60862781-60862803 TAGTGTGGTTGCCAAGTGGGTGG - Intergenic
1083436696 11:62647948-62647970 CTGTTTGGTGGGCAAGTAGATGG - Exonic
1084603604 11:70160495-70160517 CGGTATGTTTGGCAAGAGGAGGG + Intronic
1086552365 11:88067748-88067770 GGGTGTGGGTGGCAAGGGGAGGG + Intergenic
1087211675 11:95451246-95451268 CAGAGTGGTTGGCATCTGCAAGG - Intergenic
1087759911 11:102094317-102094339 CATTCTGGTTGGCAACTGCAGGG + Intergenic
1088624399 11:111718958-111718980 CAGTGTGCGTGGCAACTGCATGG + Intronic
1088935493 11:114395792-114395814 CAATGTCTTTGGCAAGTGGGTGG - Intronic
1089778812 11:120858497-120858519 CAGTGTGTTTGGGAAGTTCAGGG + Intronic
1090261944 11:125327604-125327626 GAGTGTGGAGGGCAAGAGGAGGG + Intronic
1090263163 11:125337201-125337223 CAGTGTGAATGGCCTGTGGAAGG + Intronic
1090777160 11:129975671-129975693 CAGTGTGGCTGGGCAGAGGAAGG - Intronic
1202810788 11_KI270721v1_random:26444-26466 CTGTGTGGCTGGAAGGTGGAGGG - Intergenic
1093218342 12:16388904-16388926 CAGTGTAGTTGCTCAGTGGAAGG - Intronic
1095683356 12:45004260-45004282 CAGGTTTGTTGGCAAGTGGATGG - Intergenic
1097349124 12:58528225-58528247 CAGAGTGGTTGGGAAGCTGAGGG + Intergenic
1097801034 12:63914271-63914293 CACTGTGGTTGGAATTTGGAAGG - Intronic
1098461313 12:70735833-70735855 CACAGTGGTTGGCAGGTGGCAGG + Intronic
1099052176 12:77793463-77793485 GGGTGTGGGGGGCAAGTGGAGGG - Intergenic
1099176142 12:79424632-79424654 GAATGTGGTTGGCAGGTGGTTGG + Intronic
1103061034 12:117858753-117858775 TAGTCTAGCTGGCAAGTGGATGG - Intronic
1103723202 12:122985655-122985677 GAGTGAGGGTGGCCAGTGGATGG + Exonic
1105598821 13:21866938-21866960 CAGTGAAGTTGTCATGTGGACGG + Intergenic
1105967601 13:25398777-25398799 CAGTGAGGTTGAGAAGTGGCAGG + Intronic
1105980581 13:25513201-25513223 CGGTGCGGTTGCCAGGTGGAGGG + Intronic
1106488198 13:30191181-30191203 CAGAGTGGTGGGCAATTGGCTGG + Intergenic
1107213962 13:37893395-37893417 CAATGTAGATGGCAAGTTGATGG - Intergenic
1107841111 13:44458933-44458955 CACTGTGGATGGCATGTTGATGG + Intronic
1109481099 13:62955000-62955022 CAACGTCTTTGGCAAGTGGACGG + Intergenic
1109886460 13:68552063-68552085 CAGTGTGACTGGCCAGAGGATGG + Intergenic
1111595343 13:90403921-90403943 CACTATGGATGGCAAGTTGATGG + Intergenic
1113532298 13:111037163-111037185 CAGTGAGGTGGGGAAGTGGGGGG + Intergenic
1114378180 14:22172144-22172166 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1114379060 14:22181250-22181272 CACAGTGGTTGGCATGTGGTAGG + Intergenic
1114398076 14:22384716-22384738 CAGTGTTGTGGGGAAGTTGAAGG + Intergenic
1115126313 14:29998710-29998732 GAGTGTAGTCAGCAAGTGGAGGG + Intronic
1116541450 14:46107158-46107180 CAGTGTGGTGAGCAAGGGAAGGG + Intergenic
1117596837 14:57333686-57333708 CGGGGTGGTTGCCAGGTGGAGGG - Intergenic
1117737605 14:58783332-58783354 CAGTGCAGTTGTCAAGGGGAGGG + Intergenic
1118297476 14:64583848-64583870 CAGTGTGTATGGCAACTCGAGGG + Intronic
1118722736 14:68605899-68605921 AAGTGTGGTTGGTAGGTAGAGGG + Intronic
1119029030 14:71176996-71177018 CAGTGTGGTTGGCAAGGGCTGGG + Intergenic
1119195497 14:72714323-72714345 CACTGAGGTTGGCAGGCGGATGG + Intronic
1121634771 14:95446474-95446496 CAATGTGGTGGGCCAGTGGTGGG - Intronic
1121928325 14:97949069-97949091 CAGAGGGGTTGGCAAGCGGGTGG + Intronic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1124925278 15:34064452-34064474 AAGTTTGGTTGCCAAATGGAAGG + Exonic
1125240786 15:37573422-37573444 CAGTGTAGTAGGCATGAGGATGG - Intergenic
1125608525 15:40955987-40956009 TGGTGTGGTGGGCAGGTGGAGGG + Exonic
1126390567 15:48145976-48145998 CAGTGTGCTTGTCAACTGCATGG - Intronic
1128603218 15:69015344-69015366 CAGTGTGGTGGGCCTGTGCAAGG - Intronic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1129265890 15:74392858-74392880 CAGTAGGGTTTGCCAGTGGATGG - Intergenic
1129704720 15:77787603-77787625 CAGGGAGGTTGGCATGGGGAGGG - Intronic
1132626452 16:893977-893999 CAGTGGGGTGGACAGGTGGATGG - Intronic
1133583492 16:7169050-7169072 CAGTGTAGTTTGCATGTGGAGGG + Intronic
1133721866 16:8502186-8502208 GAGTGTATTTTGCAAGTGGAAGG + Intergenic
1134069299 16:11250693-11250715 CAGGGTGGTTGGACAGTGGATGG - Intronic
1136560576 16:31036866-31036888 CAGTGTGGATGGGCAGAGGAAGG + Intronic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1138392849 16:56682853-56682875 CAGGGTGGATGGGAAGTGGGGGG + Intronic
1138467279 16:57201161-57201183 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138467298 16:57201241-57201263 CGGTGTGGCTGCCAGGTGGAGGG + Intronic
1138512543 16:57516865-57516887 CAGAGTGGCTGGGAAGAGGAAGG + Intronic
1138836846 16:60447841-60447863 CAGTGAAGTTGGTATGTGGAAGG + Intergenic
1139629675 16:68221907-68221929 AAGTGTACTTGGTAAGTGGATGG + Intronic
1140591160 16:76354476-76354498 CAGGGTGGTGGGTAAGAGGATGG - Intronic
1141066201 16:80916017-80916039 CACGGTGGTGGGCAAGAGGAAGG - Intergenic
1142032340 16:87844783-87844805 CAGAGTGGTTGGAAGGCGGAAGG - Intronic
1143902373 17:10183926-10183948 CAGAGTGCTTGGCAAGAGGGTGG - Intronic
1144619339 17:16806973-16806995 CAGTGTGTGTGGCGAGTGTATGG + Intergenic
1144771559 17:17762372-17762394 CAGTGTGGTTGGAGTGTGCATGG + Intronic
1144893354 17:18508732-18508754 CAGTGTGTGTGGCGAGTGTATGG - Intergenic
1146012779 17:29208871-29208893 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1150444368 17:65217175-65217197 CAGGGTGGCTGGGAAGTGGAAGG - Intronic
1152574742 17:81135070-81135092 CAGTGGGTTTGGCAAGGGGACGG - Intronic
1153605500 18:6827707-6827729 CGGTGTGGTTGCCGGGTGGAGGG + Intronic
1155012681 18:21796391-21796413 CAGGGTGGGGGGCAAGGGGAGGG + Intronic
1159737547 18:72119417-72119439 CAGTGTGGTAGGACAGTGGAAGG - Intergenic
1161461618 19:4400803-4400825 CAGGGAGGTTGGGAAGTAGAAGG + Intergenic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1167023740 19:46898979-46899001 GAGATTGGTTGGCAAGTGGAAGG - Intergenic
1168191187 19:54739761-54739783 GTGTGTGGTTGGGAAGTGGTAGG + Intronic
927678418 2:25123750-25123772 CAGGGTGGTGGGGGAGTGGATGG + Intronic
928243390 2:29606016-29606038 CAGTGGGGGTGGGAGGTGGAAGG - Intronic
929806370 2:45149626-45149648 CAGTGTGTTTGGCTAGCTGAGGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936713503 2:115160911-115160933 CAGTGTGTTTGGCACGTGGTAGG + Intronic
937726751 2:125175916-125175938 CAGTGTGGATGGGAAATGTAGGG + Intergenic
937861507 2:126714969-126714991 CAGTGTGGATGGCAAGTGGGAGG - Intergenic
938423785 2:131167245-131167267 CGGGGTGGGGGGCAAGTGGAGGG - Intronic
940710928 2:157162795-157162817 CAGTGTGGTTGGCAAAATGAGGG - Intergenic
940728696 2:157364494-157364516 CAGTGTGGTAGGCAAGAGACAGG + Intergenic
941047328 2:160691194-160691216 CAGTGGGGGTGGGAGGTGGAGGG + Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
942512996 2:176722687-176722709 CAGTGGGGATGGCAGGTGGGAGG + Intergenic
942671168 2:178377658-178377680 CAGGGTAGATGGCAAGTGCAGGG - Intronic
942803396 2:179902077-179902099 GGGTGTGGTGGGCAAGGGGAGGG - Intergenic
944154657 2:196596595-196596617 CAGTGTGGTTGTGATGTGGGTGG - Intergenic
944451927 2:199852033-199852055 GAGGGTTGTTGGCAAGAGGAGGG + Intergenic
945297327 2:208183559-208183581 CAGTGTGGTGGGAATTTGGAGGG + Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
946378225 2:219327170-219327192 CAGTGTGGCTGGGATGTGGCTGG + Intergenic
946483579 2:220079345-220079367 CAGGGTGGTAGGCATGGGGAGGG + Intergenic
946575545 2:221071671-221071693 CAGTGTGGAAGGGAAGTGTAGGG - Intergenic
1168792708 20:590622-590644 CAGTGTGATTGGAGAGAGGATGG + Intergenic
1170428486 20:16258068-16258090 GTGTGTGTTTGGGAAGTGGAAGG - Intergenic
1170894089 20:20398633-20398655 CAGTGTGGAGGGCACCTGGAGGG + Intronic
1170937190 20:20820634-20820656 GAGTGTGGTTGGGAAGAGCAAGG + Intergenic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1173971129 20:47153075-47153097 CAGTGTGGTGGGCATTTGGGTGG - Intronic
1175202863 20:57290075-57290097 CACTGTGGTTGGCACCAGGAAGG + Intergenic
1175312889 20:58024245-58024267 CACTGTGGATGGCAGGTTGATGG - Intergenic
1176179722 20:63743546-63743568 CCCTGTGGTGGGCAAGTGGGTGG + Intergenic
1177889966 21:26793317-26793339 AAGTGTGCTTGGCAAGTTTAAGG + Intergenic
1179398403 21:41061896-41061918 CAGTGGACTTGGCAAGTGCACGG - Intergenic
1179639962 21:42741109-42741131 CAGTCTGGTTCACACGTGGAAGG - Intronic
1182146208 22:27998442-27998464 CAGTGGGGTTGGGGAGGGGAGGG - Intronic
1182371549 22:29814724-29814746 CACTGTGGTTTGCAAGGGGACGG - Exonic
1183192099 22:36328107-36328129 CACGGTGTCTGGCAAGTGGAAGG + Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183516358 22:38268989-38269011 CAGTGTGGCTGTCACGTGGCTGG - Intronic
1183674427 22:39291696-39291718 CAGTGGGGTTGGCCAGGGGGAGG - Intergenic
1184309766 22:43633720-43633742 CGGTGTGGTGGGCAGATGGATGG + Intronic
1184712413 22:46260199-46260221 CACTCTGGCTGGCAAATGGAGGG + Exonic
949378895 3:3422369-3422391 GAGTGTATTTTGCAAGTGGAAGG - Intergenic
949779328 3:7668354-7668376 CACTGTGGGTGGCAAATAGAGGG - Intronic
952182325 3:30930779-30930801 GAGGGTGGGTGGCAAGGGGAGGG + Intergenic
952498205 3:33934771-33934793 CAGTGGGGATGGCAAGTACAAGG - Intergenic
954456528 3:50602669-50602691 CAGAGTGGTTGGAGAGTGGCTGG - Intergenic
954603130 3:51887799-51887821 CATTGTGGGTGGCATCTGGAAGG + Intergenic
954633642 3:52059849-52059871 CAGTGTGGTGTGGTAGTGGATGG - Intergenic
955111923 3:55958548-55958570 CACTGTGGATGGCATGTTGATGG - Intronic
955445030 3:59000690-59000712 GAGAGTGGGTGGCAATTGGAGGG + Intronic
955517241 3:59738437-59738459 GAGTGGGGTGGGAAAGTGGAAGG - Intergenic
955581677 3:60429669-60429691 CAATGTGGTTGGGATGAGGATGG + Intronic
956498150 3:69850933-69850955 CAGAGTGGGTGGCAAGTGATGGG - Intronic
959726468 3:109548369-109548391 CTGTATGGTTGGCAGGTGCAGGG + Intergenic
962070900 3:132033523-132033545 GTGGGTGGTTGGGAAGTGGAGGG - Intronic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
965472359 3:169110357-169110379 CATTGTGCTTGGCATGTGGAAGG - Intronic
966566112 3:181383365-181383387 CAGTGTGGTTGGGGAATGGCTGG - Intergenic
968442777 4:632933-632955 CAGTGAGGTTGGCAAGGGATGGG + Intronic
969302354 4:6304552-6304574 CAGTGTGGTGGCCCAGGGGAAGG - Intergenic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
969705225 4:8788147-8788169 CAGTATGGTTGTCTGGTGGAGGG + Intergenic
969901438 4:10354242-10354264 CAGTGAAGTTGTCATGTGGACGG + Intergenic
970275454 4:14394880-14394902 AAGAGTAGTTGGCAAGTGGAAGG + Intergenic
970488332 4:16546630-16546652 CAGTGTGGATGGGAAGGGGGTGG - Intronic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
974277995 4:59751573-59751595 GAGAGTGGTTGGCTAGTGGGTGG - Intergenic
975397994 4:73899920-73899942 CAGTGTGATTGGCTAGTTTAGGG + Intergenic
975893793 4:79061925-79061947 AAATGTGATTGGCAAGTTGAAGG - Intergenic
976009963 4:80475167-80475189 CAGTGTGGTATGGAAGTTGAAGG + Intronic
976877622 4:89873844-89873866 CAGTGTGGAAGCCAAATGGATGG + Intergenic
976892042 4:90060907-90060929 CAGTGTGATTCGCAATTGAAAGG - Intergenic
977144025 4:93412739-93412761 TAGTGGGGTAGGCAAGGGGAGGG - Intronic
978554893 4:109969453-109969475 GAGGGTGGGTGGCAAGGGGAGGG + Intronic
979180972 4:117726617-117726639 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
980324495 4:131324187-131324209 CAGTGTGGAAGGCAAATGTAGGG + Intergenic
980842451 4:138280767-138280789 CAGTGTACTTGGCAACTGGGTGG - Intergenic
982278826 4:153663496-153663518 TAGTGTGGCTGGCATGTGGTTGG + Intergenic
982662460 4:158223553-158223575 GAGGGTGGTGGGCAAGGGGAGGG - Intronic
984895272 4:184533529-184533551 CAGTGTCCTTGGGAAGTGGCCGG + Intergenic
985646555 5:1087515-1087537 CAGTGCGTGTGGCATGTGGAAGG + Intronic
985837473 5:2281374-2281396 CAGGTAGGTGGGCAAGTGGATGG + Intergenic
986672467 5:10154902-10154924 CATTGTGGGTGGGAGGTGGAGGG - Intergenic
990124585 5:52498390-52498412 CAGTGCAGGTGGCAAATGGACGG + Intergenic
991978373 5:72205503-72205525 CAGTTGGGTTGGCTAGTGCATGG - Exonic
992112471 5:73509038-73509060 CAGTATGGTTTGCAAGCTGAAGG - Intergenic
993216389 5:85027930-85027952 CAGTGTGGTTGATAATTGAAAGG - Intergenic
993930302 5:93930978-93931000 CAGCATGGGTGGCAAGGGGAGGG - Intronic
993957043 5:94246933-94246955 CAGTTTGGAAGGAAAGTGGAAGG + Intronic
994246636 5:97486258-97486280 CAGTGAGGATGGCAAGTAGGGGG + Intergenic
995431057 5:112078093-112078115 CAGTGTGGAGGGTAAGAGGAGGG - Intergenic
996947970 5:129093515-129093537 CAGTGTGGTTCTCAAGTAGGGGG + Intergenic
997129095 5:131258616-131258638 CACTGGGGATGGGAAGTGGAAGG - Intronic
997358702 5:133280769-133280791 CAGCGTGGCTGGAATGTGGAGGG - Intronic
997663163 5:135604804-135604826 CAGTGTGGTGGTCAAGAGCATGG + Intergenic
997692886 5:135838884-135838906 CAGTGTGGATGGGAAATGTAGGG + Intronic
999608611 5:153344769-153344791 CAGTGAGTTTGGCAAATGGAAGG - Intergenic
999955774 5:156700019-156700041 CAATCTGGTTGGAATGTGGAGGG + Intronic
1001290644 5:170456309-170456331 GAGGGTGGGGGGCAAGTGGAGGG + Intronic
1001398405 5:171432793-171432815 CACTCTGGTTGGTAAGTGGGAGG + Intronic
1002167336 5:177356509-177356531 CAGAATGGTGGGCAAGTTGAGGG + Intergenic
1002435492 5:179228508-179228530 CAGTGTGGGTGTGAAGCGGAAGG + Intronic
1003749467 6:9040267-9040289 CACTGTGGTTAACAAGTGTAAGG - Intergenic
1003788793 6:9518464-9518486 CAGAGGGGCTGGGAAGTGGAGGG + Intergenic
1006379916 6:33691480-33691502 CACTGTGGCTGGACAGTGGAGGG + Intronic
1008258150 6:49330260-49330282 GAGTGTGTTTGGAAGGTGGACGG - Intergenic
1012765197 6:103358156-103358178 CAATGAGCTGGGCAAGTGGATGG - Intergenic
1014155389 6:118103558-118103580 CAGTGTGTTCGGCAAGTGGATGG - Intronic
1014167529 6:118242850-118242872 CAGCATGGTTAGCAAGTGTATGG - Intronic
1015620471 6:135126788-135126810 CAGTGAAGTTGTCATGTGGATGG - Intergenic
1017045505 6:150343925-150343947 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1017619416 6:156280464-156280486 CAGTGTGGAGGGTAAGGGGAGGG + Intergenic
1021086678 7:16428918-16428940 CTCTGTGCTTGGCAAGTTGATGG - Intergenic
1021402739 7:20228431-20228453 CCTTGTGATGGGCAAGTGGAAGG - Intergenic
1022007113 7:26276356-26276378 CAGTGTGGGTGACATGGGGATGG + Intergenic
1023691222 7:42790037-42790059 CAGTTTGGTTGGGAAGGGGTTGG - Intergenic
1026257346 7:68723964-68723986 CAGTCTGGTTGGTACCTGGATGG - Intergenic
1026426832 7:70303211-70303233 AAGTGGGGGTGGCATGTGGATGG - Intronic
1028205374 7:88010704-88010726 CATTGTGATTGGCATGTGGTGGG + Intronic
1030471865 7:109974711-109974733 CAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1030725706 7:112922748-112922770 CAGGGTGGCTGCCAGGTGGAGGG - Intronic
1031267352 7:119598330-119598352 AGGGGTGGTTGGCAAGGGGAGGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033679383 7:143579011-143579033 CACTGACGTTGGCAGGTGGAGGG - Intergenic
1033692454 7:143750433-143750455 CACTGACGTTGGCAGGTGGAGGG + Intergenic
1034497270 7:151430516-151430538 GAGTGTGGTGGGCCAGGGGATGG - Intronic
1034685863 7:152970812-152970834 CACTGAGGGTGGCAAGAGGAAGG + Intergenic
1034959389 7:155355546-155355568 GAGAGTGGATGGTAAGTGGATGG - Intergenic
1036773160 8:11592629-11592651 TGGTGTGGTGGGCAGGTGGAGGG - Intergenic
1037343988 8:17878503-17878525 CAGTGGTGTTGTCAAGTGAACGG + Intronic
1039583551 8:38686280-38686302 CAGTGTGGTTAAGCAGTGGAAGG - Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1042216934 8:66436979-66437001 CAGGCTGGTTAGCTAGTGGAGGG + Intronic
1042241076 8:66665492-66665514 CAGAGTGGTTGGCTCCTGGAGGG - Exonic
1042616648 8:70656879-70656901 TAGTGTGGTGGGCAAGGGGAGGG + Intronic
1047633661 8:126735667-126735689 AAGTGGGGTTGGCAAATAGAAGG - Intergenic
1047915914 8:129583565-129583587 CAGTATGGGTGGCCAGTGCAGGG - Intergenic
1048346727 8:133581413-133581435 CAGTGGGGGTGGGTAGTGGAAGG + Intergenic
1048512416 8:135074861-135074883 CAGTGTGCTTGGAAGGTGGGAGG + Intergenic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1050683409 9:8140199-8140221 CAGTCTGTGTGGCAAGTGGTAGG + Intergenic
1051340765 9:16108014-16108036 CATTGTTGCTGGCAAGTGAATGG + Intergenic
1051877374 9:21806517-21806539 CAGAGTGGGTGGCAGGTTGAGGG + Intronic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1055954989 9:81765192-81765214 GAGTGTGGTTAGCACGTGAAGGG + Intergenic
1056399529 9:86213070-86213092 CAGTGTGGTTTGCCCTTGGAAGG - Intergenic
1056765151 9:89440502-89440524 GAGTGTGGAGGGCAAGCGGAGGG - Intronic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1059567560 9:115398302-115398324 CAGTGTGGTTGGCATGGGAAGGG - Intronic
1059723843 9:116986885-116986907 CAGTGTGCTTGGAAAATGGTGGG + Intronic
1060658417 9:125388470-125388492 ATGTGTGTTTGGCAAATGGACGG + Intergenic
1061135583 9:128731537-128731559 CAGAGTGGCTGGCATGTGCAGGG + Intronic
1062117865 9:134818783-134818805 CAGAGGGGTTGCCGAGTGGAGGG + Intronic
1185749605 X:2600193-2600215 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1186266061 X:7835016-7835038 CATTCTGGTTACCAAGTGGAAGG + Intergenic
1189436605 X:40998359-40998381 GAGAGAGGTTGGCAGGTGGATGG - Intergenic
1189570039 X:42285863-42285885 CAGGGTGGTTGCCAGGCGGAGGG + Intergenic
1192234521 X:69287200-69287222 CAGAGTGGATGGAAAGTGCAAGG + Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1195880319 X:109586445-109586467 CACTGCGGATGGCATGTGGATGG - Intergenic
1197272514 X:124440908-124440930 CAGTTAGGTAGGCATGTGGAAGG - Intronic
1197692348 X:129515384-129515406 CAGTGTGGTGGGCACGTGCCTGG + Intronic
1197960375 X:131998670-131998692 CAGTGTGGTTGCAAGGTGCAGGG - Intergenic
1201310963 Y:12597877-12597899 CAGGGTGGCTGGAAAGAGGAGGG + Intergenic
1201370658 Y:13259523-13259545 CAATGTGGCTGGAAAGTAGATGG - Intronic