ID: 1137300266

View in Genome Browser
Species Human (GRCh38)
Location 16:47143026-47143048
Sequence TGCTGCGGCCACGGAGGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 421}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137300266_1137300275 2 Left 1137300266 16:47143026-47143048 CCGCAGCCTCCGTGGCCGCAGCA 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1137300275 16:47143051-47143073 TGGGACCCGGCTGGCCCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 276
1137300266_1137300284 28 Left 1137300266 16:47143026-47143048 CCGCAGCCTCCGTGGCCGCAGCA 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1137300284 16:47143077-47143099 CGTTCCCCGCCGCGAGGTGCAGG 0: 1
1: 0
2: 0
3: 1
4: 52
1137300266_1137300280 22 Left 1137300266 16:47143026-47143048 CCGCAGCCTCCGTGGCCGCAGCA 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1137300280 16:47143071-47143093 AGGCCCCGTTCCCCGCCGCGAGG 0: 1
1: 0
2: 3
3: 11
4: 125
1137300266_1137300274 -7 Left 1137300266 16:47143026-47143048 CCGCAGCCTCCGTGGCCGCAGCA 0: 1
1: 0
2: 1
3: 39
4: 421
Right 1137300274 16:47143042-47143064 CGCAGCAGGTGGGACCCGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137300266 Original CRISPR TGCTGCGGCCACGGAGGCTG CGG (reversed) Intronic
900095698 1:939281-939303 TGCTGCTGCCGCGGGAGCTGGGG + Exonic
900134385 1:1108796-1108818 TGCTGCAGACATGGTGGCTGTGG - Intronic
900134432 1:1109076-1109098 TGCTGCAGACATGGTGGCTGTGG - Intronic
900188383 1:1343306-1343328 TGCTGCTGCTGAGGAGGCTGGGG - Intronic
900409656 1:2506918-2506940 GGCTGGGGTCACAGAGGCTGGGG + Intergenic
900414726 1:2529733-2529755 GGCGGCGGCGACGAAGGCTGCGG + Exonic
900569146 1:3349841-3349863 TGCGGGGGCTGCGGAGGCTGAGG - Intronic
900865543 1:5266299-5266321 TGCTGCAGCCAAGGAAGCTTTGG - Intergenic
901110542 1:6790062-6790084 GGCTGAGGCAAGGGAGGCTGAGG - Intronic
901442954 1:9290681-9290703 TGCTACGGCCACGTGGCCTGGGG - Intergenic
902317812 1:15636554-15636576 TGCTTGGGCCTGGGAGGCTGAGG - Intronic
902746276 1:18476600-18476622 TCCTGTGCCCATGGAGGCTGTGG - Intergenic
903420796 1:23217044-23217066 GGCAGCGCCCAGGGAGGCTGCGG - Intergenic
903810634 1:26033276-26033298 TGCTGCGGGCATCGAGGCTGAGG - Exonic
905145286 1:35883257-35883279 GGCGGCGGCAACGGAGGCTGCGG + Exonic
906182045 1:43830113-43830135 TGCTTGGGCCGGGGAGGCTGAGG - Intronic
906190946 1:43899162-43899184 AGCGGCGGCAGCGGAGGCTGAGG - Exonic
906699765 1:47849444-47849466 TGCTTCGGCCACCCAGTCTGTGG + Intronic
906997573 1:50813542-50813564 TGCTTCAGCCATGGAGGTTGAGG - Intronic
908129137 1:61057292-61057314 TGCGGCGGCTGCGGCGGCTGCGG + Intronic
908132056 1:61083356-61083378 GGCTGCGGCAGCGCAGGCTGCGG - Intronic
908293206 1:62688268-62688290 TGCTGCGGCGACGGCGACGGCGG + Exonic
908477606 1:64505412-64505434 TGCTGCACCCTTGGAGGCTGCGG + Intronic
910638614 1:89437111-89437133 AGCTGTGCCCACGGAGCCTGAGG - Intergenic
910851365 1:91652200-91652222 GGCTGGGGCCAAGGAGGCTCTGG + Intergenic
912828343 1:112926793-112926815 ACCTGAGGCCAGGGAGGCTGAGG + Intronic
912933296 1:113982786-113982808 TCCTGCTGCCACGGCGTCTGCGG + Intergenic
914939928 1:152013778-152013800 TGCTTTGGACAGGGAGGCTGAGG + Intergenic
915172335 1:153986560-153986582 TTCTGAGGCCAGAGAGGCTGGGG + Intergenic
915246317 1:154558522-154558544 TGCTGCTGCCCCTGCGGCTGCGG + Exonic
915288879 1:154869762-154869784 TGCTGAAGCTGCGGAGGCTGAGG + Exonic
917061803 1:171049320-171049342 TACTGCTGCCACTGGGGCTGGGG - Intronic
920215076 1:204357262-204357284 TGCTTCTGTCAGGGAGGCTGAGG + Intronic
920239430 1:204534569-204534591 TGCTTGTGCCACGGAGGCGGAGG - Intronic
922582992 1:226712323-226712345 TGCAGTGACCACGAAGGCTGGGG - Intronic
922799987 1:228360756-228360778 TGCTGCTGCCATGGTGGCTTGGG + Intronic
923601799 1:235410161-235410183 TGCTTCAACCAGGGAGGCTGAGG + Intronic
924011318 1:239668180-239668202 TGCTTGGGCCTCGGAGGCAGAGG - Intronic
1064008398 10:11715733-11715755 TCCTGCTACCCCGGAGGCTGTGG + Intergenic
1064420805 10:15189258-15189280 TGCTTCAGCCCAGGAGGCTGAGG - Intergenic
1064552999 10:16521260-16521282 TGCTCCCCCCGCGGAGGCTGCGG + Exonic
1064645377 10:17454342-17454364 GGCTGCGGCCACGGCGGCGGTGG - Intergenic
1064991616 10:21261561-21261583 TGCTTAGGCCCGGGAGGCTGAGG + Intergenic
1065353843 10:24820010-24820032 TGCTGGAGCCCTGGAGGCTGAGG + Intergenic
1066399376 10:35060182-35060204 TGCTAGGGCCCAGGAGGCTGAGG + Intronic
1069011904 10:63383614-63383636 TGCTTCAGCCAGGGAGGTTGAGG + Intronic
1072270618 10:93772994-93773016 TGCTGGAGCCAGGGAGGCGGAGG + Intronic
1072915523 10:99535453-99535475 TGCTGCGGCGGCGGCGGCGGCGG - Exonic
1073773108 10:106756978-106757000 TGCTGCAGCCAAGGAGACGGGGG - Intronic
1076363580 10:129907568-129907590 TGCTGCGGCCAGGAAGGGTTGGG - Intronic
1076746103 10:132515292-132515314 TGCCTCCGCCACAGAGGCTGAGG - Intergenic
1076792272 10:132784001-132784023 AGCCCCGGCCACAGAGGCTGCGG + Intergenic
1076799171 10:132812669-132812691 GGCTGCGGCCACAGGGGGTGGGG + Intronic
1077020875 11:416721-416743 GGCTGCGGCCCCGCAGGCCGAGG + Intronic
1077094379 11:793121-793143 TGCTGCAGTGGCGGAGGCTGGGG - Intronic
1077115841 11:884320-884342 GGTTGGGGCCACAGAGGCTGGGG + Intronic
1077256367 11:1585218-1585240 TGCGGCTGCTCCGGAGGCTGTGG - Exonic
1077340189 11:2023000-2023022 GGCTGAGGACACAGAGGCTGTGG + Intergenic
1077434818 11:2533938-2533960 AGCTGCGGCCCCGGAGGCCTAGG + Intronic
1077442487 11:2575160-2575182 TGCTGCGGGCTGGGGGGCTGGGG - Intronic
1077674966 11:4187447-4187469 TGCGGCGGCCGCGGCGGCGGCGG + Intergenic
1078403208 11:11045625-11045647 TGCTGCAGCCTCGGAGACCGAGG + Intergenic
1081975144 11:47229141-47229163 TGCTGGGGCCCCTGAAGCTGAGG + Intronic
1082767555 11:57181346-57181368 TCCAGCAGCCACTGAGGCTGAGG + Intergenic
1083571306 11:63763485-63763507 TGCTACGGCCACGAGGGCTTCGG - Exonic
1083796915 11:65022116-65022138 TACTGCTGCTACCGAGGCTGTGG + Exonic
1083897042 11:65625165-65625187 TGCTCTGGCCACGGAGTCTGCGG - Exonic
1083901165 11:65644228-65644250 TGCTGCAGCCAGGGAGGGGGAGG + Intronic
1083970365 11:66070571-66070593 TGCTGCGGCGGCGGCTGCTGAGG - Exonic
1084010334 11:66344885-66344907 TGCTTCGGCCTCGGAGGAGGAGG + Intronic
1084195089 11:67520030-67520052 AGGTGCGGCCACTGGGGCTGAGG - Exonic
1084204412 11:67583679-67583701 TGCAGCGGCCGCCGGGGCTGGGG + Exonic
1084284168 11:68120948-68120970 GGCTGCGGCGGCGGGGGCTGGGG + Exonic
1084417581 11:69042342-69042364 TGCTGCCTGCACTGAGGCTGGGG - Intergenic
1084876910 11:72139780-72139802 TGCTGCGGCCATGAATGCTGGGG + Exonic
1084881975 11:72177920-72177942 TGCTGCGGCCATGAATGCTGGGG + Intergenic
1085300102 11:75452904-75452926 GGCTGCTGCCACTGAGGCAGGGG + Intronic
1085332956 11:75668218-75668240 TGCTGCGGCGGCGGTGGCTGCGG + Exonic
1088344259 11:108804988-108805010 TGCTGCCCACACTGAGGCTGAGG + Intronic
1089209635 11:116791488-116791510 AGCAGCGGCCACAGAGGTTGAGG + Intronic
1202823174 11_KI270721v1_random:78189-78211 GGCTGAGGACACAGAGGCTGTGG + Intergenic
1092239772 12:6829421-6829443 TGCTGCGGTACCGGCGGCTGCGG - Intronic
1096045816 12:48561017-48561039 TGCTTCAGCCTCGGAGGCAGAGG + Intergenic
1096174144 12:49501033-49501055 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1097009945 12:55945871-55945893 TGCTTGGGCCAGGGAGGCAGAGG - Intronic
1097029327 12:56080176-56080198 TGCTGCGGCGACGGCAGCGGAGG - Exonic
1097176522 12:57146623-57146645 CGCTGAGGCCACGGAGAGTGAGG - Intronic
1101253829 12:102958348-102958370 GGCTGCGGCCGCCGCGGCTGCGG - Exonic
1101451452 12:104782923-104782945 TGCTGCGGCCACTGCTGCTATGG + Intergenic
1102288888 12:111682826-111682848 TGCTTCAGCCCAGGAGGCTGAGG + Intronic
1102872704 12:116426489-116426511 GGCTGGGGGCAAGGAGGCTGAGG + Intergenic
1103583424 12:121933565-121933587 GGCTGTGGCCAAGGAGGCTGAGG + Intronic
1103718357 12:122959767-122959789 AGGGGCGGCCACCGAGGCTGAGG - Exonic
1103718410 12:122959996-122960018 CGCTGGGGCCCCGGCGGCTGCGG - Exonic
1104376204 12:128267145-128267167 TGCGGAGGCTGCGGAGGCTGCGG + Intergenic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1110119747 13:71866486-71866508 AGCAGCGGCAACGGAGGCGGCGG - Exonic
1110212774 13:72992693-72992715 TCCAGCTGCCAAGGAGGCTGAGG + Intronic
1110219626 13:73059373-73059395 TCCTGCGGCGCCGGCGGCTGGGG - Exonic
1110472395 13:75874918-75874940 TGGTGGGTCCAGGGAGGCTGGGG - Intronic
1110857721 13:80314629-80314651 TGCTTCAGCCAGGGAGGTTGAGG + Intergenic
1111968887 13:94890161-94890183 TGCTTGAGCCAAGGAGGCTGAGG - Intergenic
1113202699 13:107884782-107884804 TGCTGCTGGCATGGAGCCTGGGG - Intergenic
1113328080 13:109302146-109302168 TGCTGAGGCCAGGGGGACTGAGG - Intergenic
1118425027 14:65651084-65651106 TGCTACAGCCACAGAGACTGTGG + Intronic
1119357424 14:74018974-74018996 AGCCGCGGCCACGCTGGCTGCGG + Intronic
1120790826 14:88580109-88580131 TGCTGGAGCCCGGGAGGCTGAGG + Intronic
1120790835 14:88580141-88580163 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1120790853 14:88580219-88580241 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1121697703 14:95927222-95927244 TGCAGGGGCCACGGGGGCAGTGG - Intergenic
1122097672 14:99383417-99383439 TGCTAAGGCCACGAAGGCAGGGG + Intergenic
1122140471 14:99660170-99660192 TGGGGCGGCCACGGAGGGAGGGG - Intronic
1122444994 14:101761704-101761726 TGCGGCAGCCACGGCGGCGGCGG - Intergenic
1122883063 14:104698795-104698817 GGCTGAGGCCCCGGAGGCTGAGG - Intronic
1123117369 14:105900745-105900767 TGCGGGGGCTCCGGAGGCTGTGG + Intergenic
1123188636 14:106545353-106545375 TGGTGCAGTCACGGAGGCTGGGG + Intergenic
1202918332 14_KI270723v1_random:5867-5889 TCCTGCGGCCCCCGTGGCTGGGG + Intergenic
1202926297 14_KI270724v1_random:28710-28732 TCCTGCGGCCCCCGTGGCTGGGG - Intergenic
1123475807 15:20592136-20592158 TGCAGGGGCTGCGGAGGCTGAGG - Intergenic
1124469273 15:29968792-29968814 TGCGGCGGCGGCGGAGGCGGCGG - Intronic
1124584469 15:30991956-30991978 TGCGGGGGCCACGGCGGCAGCGG + Intergenic
1124929184 15:34102130-34102152 TGCGGCAGCCACGGAGGCCAAGG + Exonic
1125578555 15:40770554-40770576 TGGGGCGGCCACGGCGGCTCCGG + Exonic
1125805147 15:42487405-42487427 TGCTGGGGCCAAGGAGTTTGAGG + Intronic
1127946076 15:63755268-63755290 TGCTGCTGTCACAGAGGATGGGG - Exonic
1128326527 15:66727437-66727459 GGCGGCTGCCAGGGAGGCTGGGG + Intronic
1128480827 15:68036475-68036497 GGCTGCTGCCACCGGGGCTGAGG + Intergenic
1128585288 15:68844024-68844046 AGCTGCTGCCACGGTGGCAGCGG + Intronic
1128655870 15:69461706-69461728 TGCTTCAGCCAGGGAGGCGGAGG + Intergenic
1129180695 15:73873106-73873128 TGCTGGGGCCTGGGGGGCTGGGG - Intergenic
1129530649 15:76261628-76261650 TGCTGCCGCCACAGCAGCTGGGG - Intronic
1129800757 15:78412262-78412284 TGCTTGGGCCAGGGAGGCAGAGG + Intergenic
1129904664 15:79178022-79178044 TGCTGCTGTCACTGATGCTGTGG + Intergenic
1130564496 15:84981968-84981990 CGCTGCGGCGGCGGCGGCTGCGG - Exonic
1130854564 15:87830102-87830124 AGTGGGGGCCACGGAGGCTGAGG - Intergenic
1131265013 15:90910642-90910664 TGGCACGGCCAAGGAGGCTGTGG + Exonic
1132145257 15:99425638-99425660 TGCTCCTGCCACGGAGCCAGGGG + Intergenic
1132152716 15:99474068-99474090 TGCTGCGGCCATGCAGGCTGAGG + Intergenic
1132500682 16:283374-283396 TGCTGGGGCCAGTGGGGCTGGGG + Intronic
1132628966 16:907472-907494 TCCGGCGGGCACAGAGGCTGTGG + Intronic
1132835019 16:1948616-1948638 TGCTTCGGCCCGGGAGGCTGAGG - Intronic
1132903444 16:2270612-2270634 TGCTAAGGCCATGGAGGCTGAGG + Intergenic
1133335564 16:5004612-5004634 TGCTGGGCCCCAGGAGGCTGAGG - Intronic
1136220194 16:28823494-28823516 TGCTGCGGCGGCGGCGGCTGCGG - Exonic
1136451914 16:30358372-30358394 TCTTGAGGCCAGGGAGGCTGAGG + Exonic
1136539864 16:30923390-30923412 TCCTGCGGCCACTGATGCTACGG - Intronic
1136551329 16:30984089-30984111 TGCTGAGCCCACTAAGGCTGGGG - Exonic
1136988992 16:35140590-35140612 TGCTGCGGTGGCGGGGGCTGCGG - Intergenic
1137269360 16:46893474-46893496 TGCTGGAGCCACGGATGCGGAGG + Intronic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1137505811 16:49052867-49052889 TGCTGCAGCCAGAGAAGCTGTGG + Intergenic
1137632865 16:49959655-49959677 TGCTGAGTGCACGGAGGCTGGGG + Intergenic
1138533332 16:57646746-57646768 AGATGCGGACACTGAGGCTGGGG - Intronic
1138548761 16:57735829-57735851 AGCTGCGGCTCCGGAGGCCGAGG - Exonic
1138590702 16:57998198-57998220 TGCTGAGGCTGCGGTGGCTGTGG + Exonic
1138656888 16:58496527-58496549 GGCTGCCCCCACGGAGGCAGGGG - Intronic
1140628942 16:76828844-76828866 TGCTGAGTCCTCAGAGGCTGAGG + Intergenic
1140833538 16:78772939-78772961 TGCTTGGGCCCAGGAGGCTGAGG + Intronic
1141447361 16:84069814-84069836 TCCTCCCACCACGGAGGCTGGGG + Intronic
1142182090 16:88676256-88676278 TGTTTCGGCCACTCAGGCTGGGG + Intergenic
1142342361 16:89531996-89532018 GGCGGTGGCCACGGAGGCTCAGG + Exonic
1142551114 17:740347-740369 TGCTGTTGCCACGGAAGCAGCGG + Intronic
1142757642 17:2025242-2025264 TGCTGCAGCCGCGGCGGCGGTGG - Exonic
1143375417 17:6464202-6464224 TGCCGCGGCCCCGGCGCCTGGGG - Exonic
1143411340 17:6711224-6711246 TGGGGCGGCCATGGAGGGTGGGG + Intronic
1143593577 17:7900629-7900651 TGCTGGGGCCACACATGCTGCGG + Exonic
1143639548 17:8188337-8188359 TGCTGCTGCTGCGAAGGCTGAGG - Exonic
1143759020 17:9087914-9087936 TCCTGCCCCCAGGGAGGCTGTGG + Intronic
1143815088 17:9506560-9506582 AGATGGGGCCACAGAGGCTGGGG - Intronic
1144565107 17:16353344-16353366 GGCAGCGGCCGCGGAGGCCGCGG + Exonic
1144780038 17:17803478-17803500 TGCTGCAGCCTGGGAGGTTGAGG - Intronic
1144840794 17:18184344-18184366 TGCGGCGGCTACGGCGGCTGCGG - Exonic
1146040940 17:29453889-29453911 ACCTGAGCCCACGGAGGCTGAGG - Intronic
1146115011 17:30127916-30127938 TGCTTCGGCCTGGGAGGTTGAGG - Intronic
1146410451 17:32579150-32579172 TGCTTCAGCCCAGGAGGCTGAGG - Intronic
1146465599 17:33083879-33083901 TGCTGTGACCACTGAGGATGTGG + Intronic
1146791508 17:35753216-35753238 GGCTGCGGCCACAGAGCCTGGGG + Intronic
1146884010 17:36459002-36459024 AGCTGGGGACACTGAGGCTGAGG + Intergenic
1146936126 17:36813659-36813681 TGCTGTGGCCACGGAGGGGAAGG - Intergenic
1147123906 17:38352535-38352557 TGCTGCCGCCCCGCAGGCCGGGG + Exonic
1147535041 17:41315376-41315398 TGCTGCGGCTCCGGGTGCTGTGG - Exonic
1147773760 17:42886022-42886044 TGCTTGGGCCTGGGAGGCTGAGG - Intergenic
1147969579 17:44212271-44212293 TGCGGTGGCCACGGAGTCGGAGG + Intronic
1148155439 17:45422331-45422353 TGCCTCAGCCAGGGAGGCTGAGG + Intronic
1149742863 17:59064042-59064064 TGCTGCAGCCCAGGAGGTTGAGG + Intronic
1151459512 17:74246162-74246184 TGCTTTGGCCACCGAGCCTGGGG + Intronic
1151573130 17:74937044-74937066 TGCTTCAGCCTGGGAGGCTGAGG - Intronic
1152082919 17:78199694-78199716 TGCTGTGGCCACCAAGGCTGGGG + Intronic
1152504528 17:80739145-80739167 TGCCGCCACCACGGAGGCCGAGG + Intronic
1152519225 17:80845619-80845641 AGCTGGGGGCACGGAGGGTGGGG - Intronic
1152703544 17:81831711-81831733 TGCTGTGGCCCCGGAGGCCCTGG - Intronic
1152711342 17:81871659-81871681 TGCGGCGGCCGCGTGGGCTGTGG + Intergenic
1153231679 18:2942968-2942990 GGCTGGGGGCTCGGAGGCTGAGG + Intronic
1153309781 18:3666870-3666892 TGCAGCTACTACGGAGGCTGAGG - Intronic
1153358566 18:4166441-4166463 TGCAGCTGCTATGGAGGCTGAGG + Intronic
1157640520 18:49208097-49208119 TGCTTGGGCCAGGGAGGCAGAGG + Intronic
1158190427 18:54821835-54821857 TGCTTCAGCCCCGGAGGCAGAGG - Intronic
1158528221 18:58234413-58234435 TGCTTAGGCCAGGGAGGCTGAGG - Intronic
1160251818 18:77210013-77210035 TGCTGACCCCAGGGAGGCTGTGG + Intergenic
1160592142 18:79951009-79951031 TCCTGCGGCCTCGGGGCCTGCGG + Exonic
1160771493 19:833813-833835 TGCTGAAGCCTGGGAGGCTGAGG - Intergenic
1160860649 19:1236071-1236093 GGCTGTGGCCATGGTGGCTGTGG + Exonic
1161153916 19:2722570-2722592 TCCTGTTGCCACTGAGGCTGGGG + Intronic
1162553921 19:11374812-11374834 TGCTGCGGCCCTAGAGGCGGCGG + Exonic
1163583711 19:18153206-18153228 GGCTGCGGCGACGGTGGCCGCGG + Exonic
1163834934 19:19567525-19567547 TCCTGCTGCCATAGAGGCTGTGG + Intronic
1164595821 19:29530159-29530181 TGCCGCGGCCTCGGGGACTGCGG - Exonic
1165102205 19:33445656-33445678 TGCTTAGGCCACCAAGGCTGTGG + Intronic
1165445142 19:35852636-35852658 CCCTGGGGTCACGGAGGCTGGGG - Intronic
1166731908 19:45064125-45064147 TGCTGCGGCAGCAGCGGCTGCGG - Exonic
1166888033 19:45973374-45973396 TGCTGCTGCTGCGGCGGCTGCGG + Exonic
1166888185 19:45973774-45973796 TCCTGGGACCACAGAGGCTGGGG + Intergenic
1166979193 19:46622785-46622807 TGCTCCGGCCTGGGAGGTTGAGG - Intronic
1167309185 19:48727083-48727105 AGCTGCGGCCACTCATGCTGTGG - Exonic
1167332427 19:48864642-48864664 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
1168420976 19:56203186-56203208 TGCTGCTGCTCAGGAGGCTGAGG - Intronic
1168465023 19:56595115-56595137 CTCCGCGGCCAAGGAGGCTGGGG - Intergenic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
925335447 2:3095702-3095724 TGCTGGGGTCAGGGAGGCTGGGG - Intergenic
927795940 2:26048790-26048812 AGCTGAGGCCAGGGAGGTTGAGG + Intronic
927847761 2:26480175-26480197 TGCTGGGCCCACGGGGGCTTCGG - Intronic
929255264 2:39803805-39803827 TGCTGGGGCCAGGGAGGTGGGGG - Intergenic
929552805 2:42905144-42905166 TGCTGAGGCAACTGAGGCTCAGG + Intergenic
930709485 2:54536947-54536969 TGCTTCAGCCCAGGAGGCTGAGG + Intronic
931591995 2:63894617-63894639 TGCTTGAGCCACGGAGGTTGAGG + Intronic
932416913 2:71579094-71579116 TGCTGTGGCCACAGGGGGTGTGG - Intronic
932494262 2:72138721-72138743 TGCTGCAGCCCCAGAGGCTCAGG + Intronic
932526562 2:72475858-72475880 TGCTGCTGCCATTGAGGCTGAGG - Intronic
932599241 2:73112682-73112704 TGCTGCGGGCCCGCGGGCTGCGG - Exonic
933764319 2:85696621-85696643 TGCTTGGGCCAGGGAGGCAGAGG - Intronic
934054388 2:88239907-88239929 TGCTGTGGCCCCTGAGCCTGCGG + Intergenic
934718326 2:96555752-96555774 TCCTGCTACCAGGGAGGCTGAGG + Intergenic
935592510 2:104855456-104855478 TGCTGCGGCGGCGGCGGCGGTGG + Intergenic
936986599 2:118316871-118316893 TGCAGCTACCAGGGAGGCTGAGG - Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
938081727 2:128373799-128373821 TGCTGCAGCCAAGCAAGCTGTGG + Intergenic
938271856 2:129979679-129979701 GGCTGCGGCGGCGGCGGCTGGGG + Exonic
938444145 2:131364121-131364143 GGCTGCGGCGGCGGCGGCTGGGG - Intergenic
938539524 2:132274817-132274839 TGCTCCAACCAGGGAGGCTGAGG - Intergenic
938693690 2:133815745-133815767 TGCTGCTGCCACTGCTGCTGGGG + Intergenic
938848011 2:135231702-135231724 TGCTGGAGCCTCGGAGGTTGAGG + Intronic
938953996 2:136281991-136282013 TGCTGCTGCCCAGGGGGCTGAGG + Intergenic
940316397 2:152331989-152332011 AGCTGCTGCTAGGGAGGCTGAGG - Intergenic
940460088 2:153953917-153953939 TGGTGCTGCCAGGGAGGCTAAGG + Intronic
941113139 2:161439807-161439829 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
941120191 2:161520991-161521013 TGCTGCAGCCCAGGAGGCTGAGG - Intronic
942450939 2:176107697-176107719 TGCGGCGGCCGCGGCGGCCGAGG + Exonic
943723943 2:191233454-191233476 TGCTTGGGCCAAGGAGGTTGAGG + Intergenic
946416308 2:219541761-219541783 CGCTACTGCCACGGAGGCTTTGG - Exonic
947742402 2:232490698-232490720 TGTGGCGGCCACGGCGGCTCCGG - Intergenic
947918653 2:233850919-233850941 TCCTGCCGCCCTGGAGGCTGGGG - Intronic
948371652 2:237493549-237493571 TGCTGAGCCCACGGAGCCCGGGG + Intronic
948382233 2:237558866-237558888 TGCAGCAGCCACGGGGGCTGGGG + Intergenic
948942006 2:241201418-241201440 TTCTGCATCCATGGAGGCTGGGG - Intronic
949045855 2:241872371-241872393 TGCTGCTGCCGAGGAGGCCGGGG - Exonic
1170987581 20:21272640-21272662 TGCTTGGGCCAAGGAGGTTGAGG + Intergenic
1171782300 20:29430529-29430551 TCCTGCGGCCCCCGTGGCTGGGG + Intergenic
1171989056 20:31681555-31681577 TGCTGGAGCCCAGGAGGCTGAGG + Intronic
1172701818 20:36857999-36858021 TGCTGGGGGCCCGGAGCCTGGGG - Intronic
1172786688 20:37473306-37473328 TTCTACGGCCACAGAGACTGAGG + Intergenic
1173230481 20:41192293-41192315 TGCTCTGGCCACGGAGGTGGTGG + Intronic
1173596278 20:44260613-44260635 TTCTGTGGCCCCGGAGGCTGGGG - Intronic
1173916767 20:46713816-46713838 GGCTGGGGCCCCGGAGGCTCAGG + Intronic
1174063983 20:47851706-47851728 GGCTGAAGCCAGGGAGGCTGGGG + Intergenic
1174339001 20:49884428-49884450 TGCCGCAGCCATGGGGGCTGTGG + Intronic
1174608120 20:51776118-51776140 TGCTTGAGCCAAGGAGGCTGAGG + Intergenic
1175795358 20:61767331-61767353 TGCTGCCCCCACCGGGGCTGTGG + Intronic
1175958469 20:62623202-62623224 GTCCGCGGCCTCGGAGGCTGTGG - Intergenic
1175966381 20:62661975-62661997 TGCTGGGGCCTCAGACGCTGAGG - Intronic
1175994293 20:62805303-62805325 AGGGGCGGCCACGGCGGCTGGGG - Intronic
1176298824 21:5088854-5088876 TGCTGCAGAAACGGAGGCAGAGG - Intergenic
1177262420 21:18748504-18748526 AGCTGCAGCCACCGAAGCTGTGG - Intergenic
1178207575 21:30487248-30487270 GGTTGTGGCCACAGAGGCTGTGG - Exonic
1178215449 21:30592515-30592537 TGCTGTGGCTACGGAGGCCTGGG + Exonic
1178215461 21:30592566-30592588 TGCTGTGGCTACGGAGGCCTGGG + Exonic
1178254380 21:31038310-31038332 GGCTGTGGCTACGGAGGCTATGG - Exonic
1179352782 21:40628995-40629017 TGCAGTGGCCAGGGAGGCCGAGG - Intronic
1179491278 21:41743135-41743157 GGCTACAGCCACGGGGGCTGAGG - Intronic
1179858202 21:44173095-44173117 TGCTGCAGAAACGGAGGCAGAGG + Intergenic
1179935903 21:44603152-44603174 TGTGGTGGCCACAGAGGCTGTGG + Intronic
1179984244 21:44912278-44912300 TGCTGTGGCCCGGGAGGCTCGGG + Intronic
1179996242 21:44975740-44975762 TGCTGGGGCCAGGGTGGCAGTGG + Intronic
1180088760 21:45523425-45523447 TGGTGTGGCCGTGGAGGCTGTGG - Intronic
1180617107 22:17135529-17135551 TGCTGCAGCCACCTAAGCTGGGG + Intergenic
1180801948 22:18636092-18636114 TGCTGCGGGGACCGAGGCTCTGG + Intergenic
1181219772 22:21359169-21359191 TGCTGCGGGGACCGAGGCTCTGG - Intergenic
1181349458 22:22244767-22244789 TCCTGTGGCCACGGTGCCTGGGG - Exonic
1181415429 22:22755575-22755597 TCCTGGGGCCACTGACGCTGAGG - Intronic
1181574793 22:23787004-23787026 TGCGGCGGCGGCGGCGGCTGAGG + Exonic
1182922569 22:34093528-34093550 TCCTGCTGCTAGGGAGGCTGAGG + Intergenic
1183109129 22:35635976-35635998 TGCTGAAGCCCAGGAGGCTGAGG - Intronic
1183369428 22:37424135-37424157 TGCTCCGGCCACAGTGCCTGGGG - Intronic
1183669617 22:39264740-39264762 TGCTGAGTCCACTGAGGCTCTGG - Intergenic
1183984500 22:41562088-41562110 TGCTGCATCCACTGGGGCTGGGG + Intronic
1184403678 22:44287910-44287932 GGCAGCAGCCACGGGGGCTGAGG + Intronic
1184643737 22:45885369-45885391 GGCTGGGGCCAGGAAGGCTGCGG - Intergenic
1185019691 22:48366944-48366966 TGCTGGGCCCACAGATGCTGGGG - Intergenic
1185026535 22:48417395-48417417 CGATGAGGCCAGGGAGGCTGCGG - Intergenic
1185075515 22:48680084-48680106 TGCTGCAGCCCCGGTGGGTGTGG + Intronic
949709892 3:6861260-6861282 TCCTGCAGGCACGGAGGGTGGGG - Exonic
949889582 3:8723821-8723843 TCCTGCAGCCAAGGGGGCTGGGG - Intronic
950023703 3:9806708-9806730 TACTGGGGCCAAGGAGGCTTGGG - Intronic
950196866 3:11015514-11015536 CGCTGCGGCCACCCTGGCTGGGG + Intronic
950604303 3:14064773-14064795 GGCTGCTGCTACGGGGGCTGGGG - Exonic
954000163 3:47550209-47550231 TGCTTGAGCCACGGAGGTTGAGG - Intergenic
954375385 3:50191716-50191738 TGCTGGGACCATGGGGGCTGGGG + Exonic
954866211 3:53732191-53732213 TGCTGAGGCCACCAAGGCCGTGG + Intronic
955301977 3:57789001-57789023 TGCTGCTCCCAAGGAGCCTGTGG + Intronic
955821920 3:62905599-62905621 TGCTGAGGCCACAGAGGCAAAGG + Intergenic
955916497 3:63912725-63912747 TGCTGCTGCCGCTGGGGCTGCGG - Exonic
956143813 3:66172325-66172347 TGCTTGGGCCCAGGAGGCTGAGG + Intronic
956669155 3:71670416-71670438 GGCTGGGGCCACGGGGGTTGGGG - Intergenic
956691268 3:71879747-71879769 TGCTGTGGCCATGAAGTCTGAGG + Intergenic
959947112 3:112136942-112136964 TGCTGAGGCCACTGAGGAAGGGG - Intergenic
960996160 3:123342006-123342028 TGCTGGGGCCCAGGAGCCTGAGG - Intronic
961081617 3:124033201-124033223 TGCTGCGGCGGCGGCGGCGGCGG + Intergenic
962080584 3:132135438-132135460 TGCTGAGGTCACAGAGGTTGGGG - Intronic
963779813 3:149475877-149475899 TGCTGCGGCAACGAGGGCTGTGG + Exonic
964773110 3:160245303-160245325 TGCGGAGGCTGCGGAGGCTGCGG + Intronic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
966899203 3:184468150-184468172 TGCGGAGGCTGCGGAGGCTGAGG - Intronic
967068244 3:185939446-185939468 TCCAGCTGCTACGGAGGCTGAGG - Intergenic
967449432 3:189606627-189606649 TGGTGGTGCAACGGAGGCTGAGG - Intergenic
968565484 4:1310429-1310451 TGCTGGTGCCACGCAGCCTGGGG - Intronic
968665880 4:1822145-1822167 TTCTGGGGCCCTGGAGGCTGAGG - Intronic
968732444 4:2275940-2275962 AGCAGAGGCCACGGAGGCGGAGG + Intronic
971236733 4:24849176-24849198 TGCTGGGGCCACAGAGACAGTGG - Intronic
976720083 4:88160763-88160785 TGCTGGAGCCAGGGAGGCAGAGG + Intronic
977290721 4:95161844-95161866 CCCTTCAGCCACGGAGGCTGAGG + Intergenic
979740750 4:124147839-124147861 TGCTGCGGTTTGGGAGGCTGAGG - Intergenic
982493750 4:156063977-156063999 GGCTGTGCCCACTGAGGCTGTGG + Intergenic
985129681 4:186726824-186726846 AGCAGCGGCCGTGGAGGCTGCGG + Intergenic
985573419 5:662681-662703 CGCTGGGGCCAGGGAGGCCGAGG + Exonic
985691113 5:1313120-1313142 TGCCGTGGCCACGGACGGTGAGG - Intergenic
985828967 5:2213726-2213748 AGCTGCCCTCACGGAGGCTGTGG - Intergenic
985972996 5:3392445-3392467 TGGGGAGGCCAGGGAGGCTGGGG + Intergenic
986939552 5:12934834-12934856 TGCTGCAGCCAGGAAGGCAGAGG + Intergenic
988773088 5:34451112-34451134 TGCTGCTACTAAGGAGGCTGAGG - Intergenic
991687160 5:69191967-69191989 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
991695393 5:69266182-69266204 GGCTGCGGCGGCGAAGGCTGGGG + Intronic
993647022 5:90474560-90474582 TGGTGCGGCTGCCGAGGCTGCGG - Exonic
995106243 5:108381030-108381052 CGCTGCGGCGGCGGGGGCTGCGG - Exonic
995260487 5:110098444-110098466 TGCAGCTGCCTGGGAGGCTGAGG + Intergenic
995481978 5:112602471-112602493 TGCTGGGGCCTAGGAGGTTGAGG + Intergenic
996425062 5:123305200-123305222 TGGTGGGGCCAGGGAGGCTGTGG - Intergenic
996518064 5:124395482-124395504 CCCTGCTGCCGCGGAGGCTGTGG - Intergenic
996862816 5:128084236-128084258 TGCTGCGGCGGCGGCGGCGGCGG + Exonic
997980606 5:138465565-138465587 CGCCGCGGCTGCGGAGGCTGGGG - Exonic
998341726 5:141423359-141423381 TGCTGCTGGCACTCAGGCTGTGG + Exonic
999657500 5:153825155-153825177 TGCTGCTGCCAGAGAGGCAGGGG - Intergenic
1001519404 5:172380139-172380161 TGCTCGGGCCAAGGAGGTTGAGG - Intronic
1002170521 5:177371767-177371789 TGCTGGGGCCAGGGAGGCAGTGG + Intronic
1002180062 5:177426694-177426716 TGCGGCGGCCGGGGAGGCCGGGG + Intronic
1002200292 5:177524212-177524234 TGTTGCGGCTCCGGCGGCTGCGG + Exonic
1002290895 5:178200042-178200064 GGCTGGGGCCATGGAGACTGGGG - Intergenic
1003240895 6:4344760-4344782 TGCTGCCCCCACGGAGGAAGAGG - Intergenic
1004216847 6:13711471-13711493 TGCTGCGGCGGCGGCGGCGGCGG + Exonic
1006001159 6:30966141-30966163 TGCAGTGGCCCCAGAGGCTGTGG - Intergenic
1006312629 6:33271645-33271667 CGCTGCGACCATGGCGGCTGCGG - Exonic
1006860726 6:37170184-37170206 TGCAGCGGCCGCGGTGGCTGAGG + Exonic
1007606566 6:43122056-43122078 TGCTTGGGCCTCGGAGGTTGAGG + Intronic
1007665292 6:43509935-43509957 TGCGGCTGCGGCGGAGGCTGCGG + Exonic
1007902223 6:45422765-45422787 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1007912097 6:45525906-45525928 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
1008545251 6:52577493-52577515 GGCTGTGGCCCCGGGGGCTGAGG + Intergenic
1008567250 6:52781509-52781531 TGCTGGGGACACAAAGGCTGTGG - Intergenic
1010938501 6:81888309-81888331 TGCTGCCACCACTGAGGGTGGGG + Intergenic
1013355350 6:109341480-109341502 AGCTGCAGCCATGGAGGCTTGGG - Intergenic
1013408924 6:109867003-109867025 TCCTGCCCCCAAGGAGGCTGTGG - Intergenic
1014044251 6:116866114-116866136 TGCTTGGGCCCCGGAGGCGGAGG - Intergenic
1015251832 6:131135534-131135556 TGCCGCTGCCGCGGGGGCTGCGG + Intergenic
1016010790 6:139135624-139135646 TGCGGCCGCCGCGGGGGCTGCGG + Exonic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016935535 6:149446717-149446739 AGATGAGGCCACAGAGGCTGTGG - Intergenic
1017163353 6:151386448-151386470 TGCTTGAGCCAGGGAGGCTGAGG + Intronic
1018686767 6:166309384-166309406 TGCTGCTGCCTCGGAGACTGAGG - Intergenic
1019267007 7:123369-123391 GGCTGCTGCCATGGTGGCTGTGG - Intergenic
1019452097 7:1104282-1104304 TGCAGTGGCCCGGGAGGCTGAGG + Intronic
1019564352 7:1672049-1672071 TGCTGCGGCCGAGGAGGAGGGGG - Intergenic
1020963726 7:14839483-14839505 TGCTGGAGCCCAGGAGGCTGAGG - Intronic
1021611202 7:22459813-22459835 TGCTGCGCTCACTGAGGGTGTGG - Intronic
1022099155 7:27158790-27158812 TGCCCCGGCCAAGGAGGATGCGG + Intergenic
1022396186 7:29989688-29989710 GGCTGCGGCCGCCGAGGGTGCGG + Intronic
1023000348 7:35801542-35801564 TGCTCCGGCCGCGGAGGCCGCGG - Intronic
1023418266 7:39951247-39951269 TGCTGCGGCCACTGCTGCTGCGG - Exonic
1023838127 7:44080270-44080292 TGCTGAGGCCTTGGAGGCTAGGG + Intronic
1023908807 7:44539841-44539863 TGCAGCTGCCACGCTGGCTGTGG - Exonic
1025295410 7:57772286-57772308 TCCAGAGGCCACGGAGGCTGTGG + Intergenic
1026572757 7:71546242-71546264 TGCTTCAGCCAGGGAGGCTGAGG - Intronic
1029201796 7:98844076-98844098 TGCTTGAGCCAGGGAGGCTGGGG + Intergenic
1029414775 7:100436000-100436022 TCCTGCGGCACCGCAGGCTGCGG + Exonic
1029728477 7:102424308-102424330 TGCTGAGGCCACCGTGCCTGCGG + Intronic
1030025957 7:105324801-105324823 TGCTTGAGCCACGGAGGCGGAGG + Intronic
1031317370 7:120273808-120273830 TGCTGCCGCCACGGCGGCGGCGG + Exonic
1034192644 7:149223871-149223893 AGCTGCGGCTGCGGTGGCTGGGG - Exonic
1034658045 7:152744932-152744954 TGCTGAGGCAATGGAGGCTGAGG - Intergenic
1034893598 7:154860702-154860724 TGCTGCACCCAAGGAGGCAGCGG - Intronic
1034991938 7:155553243-155553265 TGCTGAGGCTACAGAGGTTGGGG + Intergenic
1035315106 7:157992726-157992748 TCCTGTGGCCACGGTGCCTGGGG - Intronic
1035388372 7:158489560-158489582 GGCTGCGGCCTCGGTGGGTGGGG - Intronic
1036391737 8:8329861-8329883 TGCCTCGGTCACTGAGGCTGGGG - Intronic
1036789505 8:11708681-11708703 TGCCGCGGCCCGGGAAGCTGCGG + Exonic
1037449404 8:19001712-19001734 TGCTGCCTCCACCAAGGCTGAGG - Intronic
1037588504 8:20294554-20294576 TGCTGGGGCCACGGAGGCGTTGG + Intronic
1037808169 8:22069825-22069847 TGCTGATGGCAGGGAGGCTGGGG - Intronic
1037844542 8:22271485-22271507 TGCTGAGGCCACCCAGTCTGTGG - Intergenic
1038359859 8:26865611-26865633 TGCTGAGACCCAGGAGGCTGCGG + Intronic
1038406346 8:27325564-27325586 TGCAACGGCTCCGGAGGCTGTGG - Exonic
1038504515 8:28073084-28073106 TGCTTGAGCCACGGAGGTTGAGG - Intronic
1039469255 8:37803372-37803394 GGCTGCTCCCAGGGAGGCTGGGG - Intronic
1040739728 8:50558225-50558247 AGCTGCTGCCATGGAGCCTGGGG - Intronic
1041689913 8:60678755-60678777 TGCTGGGGCCGCGGCGGCGGCGG + Intergenic
1042241293 8:66666918-66666940 GGCGGCGGCAACGGAGGCGGCGG + Exonic
1045367983 8:101493801-101493823 GGCTCCGGCCGCGCAGGCTGTGG - Intronic
1047385861 8:124408674-124408696 GGCTTGGGCCTCGGAGGCTGAGG - Intergenic
1048867715 8:138773002-138773024 AGCTGCAGACACTGAGGCTGGGG + Intronic
1049389286 8:142359832-142359854 TGCTGTGGCCAGGGTGTCTGAGG - Intronic
1049598905 8:143498194-143498216 GGCTGCTGCCACTCAGGCTGAGG - Intronic
1049620923 8:143597980-143598002 TGCAGCGGGGACGGGGGCTGGGG - Exonic
1051566732 9:18508067-18508089 TGCAGCTGCTAGGGAGGCTGAGG + Intronic
1052340973 9:27363823-27363845 TGCTTGGGCCCAGGAGGCTGAGG - Intronic
1053290277 9:36875175-36875197 TGATGCAACCAAGGAGGCTGGGG - Intronic
1053488272 9:38478461-38478483 TGCCGGAGCCACGGAGGATGAGG + Intergenic
1055462140 9:76529014-76529036 TGCTGAGGCCAAGGAGGCACCGG + Intergenic
1057468932 9:95340479-95340501 TGCTGGAGCCCAGGAGGCTGAGG + Intergenic
1057559199 9:96114071-96114093 TGCGGCAGCCACCCAGGCTGTGG - Intronic
1058696361 9:107562510-107562532 TGCTGGAGCCCAGGAGGCTGAGG - Intergenic
1058994519 9:110286551-110286573 TGCTTGAGCCAGGGAGGCTGAGG + Intergenic
1059457080 9:114406490-114406512 TGCAGAGGCCACAGTGGCTGGGG - Exonic
1060412202 9:123407187-123407209 AGCTGGAGCCTCGGAGGCTGGGG + Intronic
1060549531 9:124478391-124478413 GGCTGAGGCCACGGGAGCTGGGG - Exonic
1061178076 9:129009255-129009277 TGCTGCGGCCACTATGCCTGTGG - Exonic
1061526399 9:131167966-131167988 CGCTTCAGCCACGGAGGTTGGGG - Intronic
1061605969 9:131711132-131711154 TGCTTGGGCCAGGGAGGTTGAGG - Intronic
1061800542 9:133111362-133111384 TGCTTCAGCCCAGGAGGCTGAGG - Intronic
1062128288 9:134878355-134878377 TGTTACGGGCAAGGAGGCTGAGG - Intergenic
1062157347 9:135060477-135060499 TGCTGAGGCCATCCAGGCTGGGG + Intergenic
1062390372 9:136331399-136331421 GGCTGGTGCCAGGGAGGCTGGGG + Intronic
1062543917 9:137053469-137053491 TGCCGCCGCCCCGGAGGGTGCGG - Intronic
1062610054 9:137369535-137369557 CGCTGGGACCAGGGAGGCTGGGG + Intronic
1062613241 9:137384202-137384224 TGTTGCTGCGAGGGAGGCTGAGG + Intronic
1062689005 9:137832001-137832023 TGCAGCGGCCACGTAGGAGGCGG - Intronic
1062689022 9:137832067-137832089 TGCAGCGGCCACGTAGGAGGCGG - Intronic
1203770909 EBV:49655-49677 GGCTGCGGCGGCGGAGGCGGCGG - Intergenic
1186452927 X:9688139-9688161 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1186475165 X:9851538-9851560 TGCTTGGGCCCAGGAGGCTGAGG - Intronic
1187142434 X:16606875-16606897 CGCTGCTGCTAGGGAGGCTGAGG - Intronic
1187877654 X:23817338-23817360 TGGTGAGGCCAGGCAGGCTGGGG - Intergenic
1188005407 X:25013164-25013186 TGCTGCGGCCACGGCGCCAGTGG + Exonic
1190086508 X:47399761-47399783 TGCTTCAGCCCTGGAGGCTGAGG - Intronic
1191600665 X:63001603-63001625 TGCTGCAGCCACTGTGGATGAGG + Intergenic
1192008258 X:67240529-67240551 TGCTGCTGCCAAGGGTGCTGAGG - Intergenic
1192180545 X:68913119-68913141 GGCTGCGGCTGCGGCGGCTGCGG - Intergenic
1192657056 X:73003255-73003277 TGCGGCGGCGGCGGAGGCTGCGG + Intergenic
1192665064 X:73079746-73079768 TGCGGCGGCGGCGGAGGCTGCGG - Intergenic
1193952222 X:87813776-87813798 TGCTGTGTCCACAGAAGCTGGGG + Intergenic
1195840287 X:109168497-109168519 GGCTGCTACCACTGAGGCTGAGG - Intergenic
1197740159 X:129885210-129885232 TGCTGGGGCCCAGGAGTCTGAGG + Intergenic
1200138499 X:153886153-153886175 TGCTGCGGCAGCAGCGGCTGTGG + Intronic
1200492971 Y:3851046-3851068 TCCTGCTGACAGGGAGGCTGTGG + Intergenic
1200840079 Y:7772945-7772967 TGCTTGGGCCTAGGAGGCTGAGG - Intergenic