ID: 1137303504

View in Genome Browser
Species Human (GRCh38)
Location 16:47177672-47177694
Sequence TCCAGAATATTCAGGGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137303504_1137303510 25 Left 1137303504 16:47177672-47177694 CCCAATGCCCTGAATATTCTGGA 0: 1
1: 1
2: 1
3: 21
4: 174
Right 1137303510 16:47177720-47177742 TAATTTCCAGTAAAATCCCAGGG 0: 1
1: 0
2: 2
3: 32
4: 299
1137303504_1137303509 24 Left 1137303504 16:47177672-47177694 CCCAATGCCCTGAATATTCTGGA 0: 1
1: 1
2: 1
3: 21
4: 174
Right 1137303509 16:47177719-47177741 CTAATTTCCAGTAAAATCCCAGG 0: 1
1: 0
2: 2
3: 21
4: 218
1137303504_1137303508 -7 Left 1137303504 16:47177672-47177694 CCCAATGCCCTGAATATTCTGGA 0: 1
1: 1
2: 1
3: 21
4: 174
Right 1137303508 16:47177688-47177710 TTCTGGATAACAGAAGATCATGG 0: 1
1: 0
2: 2
3: 29
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137303504 Original CRISPR TCCAGAATATTCAGGGCATT GGG (reversed) Intronic
903937925 1:26909645-26909667 TCCAGAAGATTCAGGGATTTAGG - Intronic
906045116 1:42824042-42824064 TCAAGAATGTTCAGGGCACGAGG + Intronic
910040774 1:82849143-82849165 CCCAGAATACTCATGGAATTAGG + Intergenic
910226375 1:84940169-84940191 TTCAGAATATCAAGGGGATTGGG + Intronic
916358700 1:163943088-163943110 CCCAGGATATACAGGGCATCTGG - Intergenic
917094355 1:171385269-171385291 TCTAGGATATTCAAGGCATGTGG - Intergenic
921469345 1:215530061-215530083 TCCACAATATTCTTGGCATGGGG - Intergenic
922169861 1:223144863-223144885 TCCAGTATATTCAGGGGAAGGGG + Intergenic
923427789 1:233889627-233889649 TTCAGAAAATTCAGGACAGTTGG + Intergenic
1064597528 10:16960951-16960973 TTCAGAATACTCTGGGCCTTGGG - Intronic
1065661744 10:28010776-28010798 TCCAGAATCTATAGGACATTTGG + Intergenic
1065845553 10:29739779-29739801 TCTTGAATATGCAGGGCATTGGG - Intergenic
1066182489 10:32976874-32976896 TTCAGAATGTGCAGGGCTTTGGG + Intronic
1066204918 10:33179646-33179668 TCTAGTATATTCTGGGCACTGGG + Exonic
1068163813 10:53302156-53302178 TCCAGAAAATTGAGAGCAGTAGG - Intergenic
1068649386 10:59504496-59504518 TCCAGAGTACTCAGGGCAGATGG - Intergenic
1070254893 10:74805500-74805522 TTCAGAAAATTCAGGGTGTTTGG + Intergenic
1074873552 10:117596392-117596414 TCCAGAATTCTCAGGGGGTTGGG + Intergenic
1078041602 11:7868741-7868763 TCTAAAATATTCAGATCATTGGG - Intergenic
1079849669 11:25515879-25515901 TCCAATTTATTCAGGGCACTGGG - Intergenic
1080598921 11:33802996-33803018 TCCAGCAAATTCAGGACATTTGG - Intergenic
1080731541 11:34960433-34960455 TCCAGAATATTGCGGGCAGCTGG - Exonic
1083131544 11:60628956-60628978 TACAGCATATTCAGGGGACTTGG - Intergenic
1085793117 11:79513197-79513219 TCCAGCATCTTTTGGGCATTTGG + Intergenic
1087584412 11:100100173-100100195 TGCAGAATTTACAGTGCATTGGG - Intronic
1087941071 11:104097979-104098001 TTCAAAGTATTCAGGGCTTTTGG - Intronic
1088589973 11:111395050-111395072 TCCACTATTTTCAGGCCATTTGG - Intronic
1091532571 12:1373885-1373907 TACAGAAAATTCAAGGCATGTGG - Intronic
1092265710 12:6978805-6978827 GCCAGACTATTGAGGGCATCTGG - Intronic
1092662940 12:10758465-10758487 GGCAGAATATTCAGGGCATGAGG + Intergenic
1093553829 12:20447400-20447422 ACCAGAATGGTCAGGGGATTGGG + Intronic
1097081454 12:56434302-56434324 TTCAGAATATTCTGAGCATTAGG - Intronic
1099062399 12:77928276-77928298 TCCAAAGTATTCAGTACATTTGG + Intronic
1101471516 12:105001074-105001096 TCCAGAAGATTAAGGGTGTTAGG + Intronic
1101563800 12:105885396-105885418 TTCATAAAATACAGGGCATTGGG + Intergenic
1103498526 12:121381930-121381952 TCCAGAATATTAGAGGGATTAGG + Intronic
1109068145 13:57727465-57727487 TCTAAAATATTGATGGCATTTGG - Exonic
1110336556 13:74338883-74338905 TCCAGCAGCTGCAGGGCATTAGG - Intergenic
1110410159 13:75195953-75195975 TCCAGAATATCCATGGCAACCGG + Intergenic
1110851708 13:80253443-80253465 TCCACAATCATCAAGGCATTGGG - Intergenic
1111500444 13:89113263-89113285 TACAGAATATTTAATGCATTAGG - Intergenic
1111910892 13:94311046-94311068 TTCAGAGCATTCAGAGCATTTGG + Intronic
1112004009 13:95238451-95238473 TCCAGAATCTTCCGGGGATGGGG - Intronic
1115066924 14:29274467-29274489 TCTAGAATATTCACCTCATTAGG - Intergenic
1129468378 15:75737085-75737107 TTCAGACTCTTCAGGGTATTTGG - Intergenic
1132095206 15:98979083-98979105 ACCAGAATCTTGAGGGCATTGGG - Intronic
1132278840 15:100594798-100594820 TCAAAAATATTTAGGGAATTGGG - Intronic
1133963388 16:10513775-10513797 TGCAGATTATTCAGCTCATTAGG - Intergenic
1137303504 16:47177672-47177694 TCCAGAATATTCAGGGCATTGGG - Intronic
1137467715 16:48726015-48726037 TACAGAAAATTCAGAGCAGTTGG + Intergenic
1137569939 16:49558836-49558858 TCCTGAATAGTCTTGGCATTGGG + Intronic
1139049310 16:63103805-63103827 TACTGAATCCTCAGGGCATTGGG + Intergenic
1139460137 16:67115500-67115522 TCCAGAATATTCAGGGCCTTTGG + Intronic
1139587962 16:67916504-67916526 TCCAGAATAAACAGGAGATTGGG + Intronic
1143365127 17:6402806-6402828 TTCAGAATATACAGTGCAATGGG + Intronic
1143555538 17:7657450-7657472 TACAGAATATTCAGAGCAGGAGG - Exonic
1144283227 17:13747570-13747592 TCCTGAATATTTATGGCACTTGG - Intergenic
1149473142 17:56935779-56935801 TCAAGGATATTAAGGGCAGTTGG - Intergenic
1155415934 18:25600001-25600023 TCCAGAATACTTTGTGCATTAGG - Intergenic
1156366615 18:36433523-36433545 TCTAGAATATTCTGGGCATGTGG + Intronic
1157879292 18:51304784-51304806 TGCTGATTATTCAGGGCCTTGGG - Intergenic
1158452966 18:57583167-57583189 TCTAGAATCTTCAGATCATTAGG - Intronic
1158879352 18:61761768-61761790 TCCAGAAAATCCAGGGGAATTGG - Intergenic
1163398457 19:17077368-17077390 TCCAGAATATCCTGGCCTTTAGG + Intronic
1164079541 19:21850643-21850665 TCCAAAATATTCAGGGACTAAGG + Intronic
1164282953 19:23785297-23785319 TGCAAAATATTCAGGGCTTAGGG - Intronic
1167701029 19:51045972-51045994 TCCAGGCTATTGAGGGCAGTGGG - Intergenic
1167707318 19:51089272-51089294 TCCAGAATATACAGATCAGTAGG - Intergenic
925024550 2:597450-597472 ATCAGAACATTCAGGGCTTTGGG + Intergenic
925193745 2:1907181-1907203 TCCAGAATTCTCATAGCATTTGG - Intronic
925951675 2:8919249-8919271 AACAGAATTTTCAGGGCATATGG + Intronic
928489712 2:31769110-31769132 ACCAGAAGATTTAGGGTATTGGG + Intergenic
928824198 2:35399388-35399410 GCCAGAATAATAAGGACATTTGG - Intergenic
928990127 2:37224473-37224495 CCCAGAGTATTCAGAGCAATAGG - Intronic
930296684 2:49563020-49563042 TCCAGCATATTGTGGGCTTTGGG - Intergenic
931008383 2:57879277-57879299 TCCAGAATATTCAGAAAATCTGG + Intergenic
931782136 2:65587962-65587984 TCTAGAGTATTCAGTGTATTAGG + Intergenic
932343680 2:70982227-70982249 TCCAAAATATCCTGGGCAGTAGG - Intronic
933715950 2:85360720-85360742 TCCAGAAAATTCAGTGAATATGG + Intronic
934123779 2:88866474-88866496 GCCAGGATTATCAGGGCATTTGG - Intergenic
938160610 2:128981675-128981697 TCAGGAAGCTTCAGGGCATTAGG - Intergenic
941399502 2:165013355-165013377 CCCAAAATATTCAGGGCAGTGGG + Intergenic
942538321 2:176988967-176988989 TCTAGAAAAATCAGGGCTTTAGG - Intergenic
945019084 2:205553062-205553084 TACAGAATATTCCTGGCATGGGG + Intronic
947518170 2:230824790-230824812 TCCAGGACGCTCAGGGCATTTGG - Intergenic
1170733070 20:18990612-18990634 TCCCAAATTTTCAGGGCATAGGG - Intergenic
1172061392 20:32189682-32189704 TCCAGAATATTCCGGGCTTCTGG - Intergenic
1172997347 20:39080954-39080976 TCCAGAACATTCTCTGCATTTGG - Intergenic
1174039498 20:47688882-47688904 GCCTGAATATTCAGGGTGTTTGG - Intronic
1174191931 20:48747125-48747147 TCCAGATTAATCAGGGCGTTTGG + Intronic
1175306501 20:57979407-57979429 TCCAGACAAATCAGGGCACTGGG - Intergenic
1177714571 21:24822538-24822560 CCCAGAACACTCAGGGCACTAGG - Intergenic
1178168293 21:30008076-30008098 ACCAGAGTATTCAGGGCCTTGGG + Intergenic
1183316469 22:37139719-37139741 TCCAGAAAATTCAAGGCGTAGGG - Intronic
949153006 3:793203-793225 TGCAAAATATTCAGGGTCTTAGG + Intergenic
950716928 3:14854310-14854332 TCCAGGAAATTCTGGGCATGTGG - Intronic
951537942 3:23756627-23756649 ACTAGAATTTTCAGGGCATCAGG - Intergenic
952445087 3:33373390-33373412 TCCAGAATGTTCATAGCTTTGGG - Intronic
952614598 3:35254776-35254798 TCCAGAATATTCAGTGTCCTGGG - Intergenic
954774559 3:53005244-53005266 TACAGCCTATTCAGAGCATTTGG - Intronic
955798258 3:62660309-62660331 TCCAGAAAATGGAGGTCATTTGG - Intronic
956329184 3:68086237-68086259 TCCAAGTTATTGAGGGCATTTGG + Intronic
956840847 3:73138472-73138494 TCCAGGATATTATGGGCTTTTGG + Intergenic
956886579 3:73566036-73566058 TCCAGAGCATTCAGGTAATTAGG + Intronic
958550925 3:95610530-95610552 TCCAGAATCATCAGGGCACTTGG + Intergenic
958791571 3:98657325-98657347 TGCAGAATATCAAGGGCTTTGGG - Intergenic
959087186 3:101863910-101863932 TCCAGGATTTTCAGGGCTTCTGG + Intergenic
960522048 3:118666219-118666241 TCCAGAATATTCTGGGTACTTGG - Intergenic
960746358 3:120894161-120894183 TCCAGAAAATTCAAGATATTTGG + Intergenic
961228799 3:125281101-125281123 TGCAAATTATACAGGGCATTTGG + Intronic
961544672 3:127624118-127624140 TCCAGAAGATTGAGGTCAGTTGG + Intergenic
963945659 3:151143611-151143633 TCCTGAAGATTCAGGGGAATGGG - Intronic
964343438 3:155731684-155731706 TCAAGAATAGTCAGGGCAGCCGG + Intronic
967206728 3:187130099-187130121 ACAAGAATATTCAAAGCATTTGG - Intronic
973871627 4:55172136-55172158 TCCAGACTCTTCAGGGGACTTGG - Intergenic
974306660 4:60151521-60151543 TCTAGAATATTTATGGCTTTAGG + Intergenic
977847987 4:101788804-101788826 TTCACAATATTCATGTCATTTGG - Intronic
979270741 4:118757986-118758008 TCCAGAATATCTAGAGCATCTGG + Intronic
980469347 4:133231242-133231264 TTCAGAAAATTCTGGGCAATGGG - Intergenic
980640106 4:135566108-135566130 TCTGGAACATTCAGGGCACTGGG - Intergenic
980647935 4:135668938-135668960 TCCAAAAAATTCAGGACATGAGG - Intergenic
981166276 4:141561788-141561810 TCCAGAATATTATAGGAATTCGG - Intergenic
981981856 4:150802721-150802743 TTCAAAATATACAGGGCATATGG + Intronic
987097557 5:14563449-14563471 TCCAGAATCATGCGGGCATTAGG - Intergenic
988140765 5:27236820-27236842 TCCAGAAAACTCAGGATATTTGG - Intergenic
988260548 5:28881937-28881959 TCCAGAATATGCACCCCATTTGG + Intergenic
988403311 5:30791260-30791282 TCCAGAATATTCTGAGGTTTGGG + Intergenic
988921868 5:35949844-35949866 CCAGGATTATTCAGGGCATTTGG + Intergenic
989258345 5:39391040-39391062 TCCAGAATATACTGGGAATACGG - Intronic
990343741 5:54850896-54850918 TCCAGACTATCCAGGGAATAAGG + Intergenic
992304476 5:75422113-75422135 ACCAGAATATTCAGGGGTTGAGG - Intronic
994527850 5:100928904-100928926 CCCAGAGTATTCAGGGGATTTGG + Intergenic
994549720 5:101216441-101216463 TTCAAAATATACAGGCCATTTGG - Intergenic
994571520 5:101520869-101520891 TTGAGAATATTCAGGGTATGTGG - Intergenic
996156227 5:120105989-120106011 TGCTGAATACTCAGGGCATAGGG - Intergenic
1000869453 5:166557589-166557611 TTCAGAATATTCAAGGCTCTTGG - Intergenic
1001050781 5:168412505-168412527 TCCACCATATGCAGGACATTGGG - Intronic
1004063654 6:12222177-12222199 TCCAGATTTTTCATGGCGTTGGG + Intergenic
1004218839 6:13727500-13727522 GCTAGAATATTCAGTGAATTGGG + Intergenic
1004451919 6:15755271-15755293 TCCAGAATATTCAAGGAAGATGG + Intergenic
1004749107 6:18542494-18542516 TTCAAAATATTCAGAGTATTAGG - Intergenic
1007234987 6:40384144-40384166 GTCAGAACATTCAGGGCATCAGG + Intergenic
1009046985 6:58245259-58245281 TTTATAATATTCAGGGAATTGGG + Intergenic
1009660408 6:66604345-66604367 TCCAGAAAATTCAAAGAATTTGG - Intergenic
1012627291 6:101419708-101419730 TCCTCAATATTTAGGACATTTGG - Intronic
1014500173 6:122178526-122178548 TCCAGAAAATTCAGAGCAATAGG + Intergenic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1015453228 6:133395136-133395158 TCCAGAACCTTCAAGGAATTTGG - Intronic
1016732221 6:147439217-147439239 TCAAGAAGATTCAGGGTTTTTGG - Intergenic
1017364007 6:153611269-153611291 TTCAAAATATTCATGGCATTTGG + Intergenic
1017799475 6:157880225-157880247 TCCTGAATAGTCAGTGGATTAGG + Intronic
1022219025 7:28293776-28293798 TCCACAATATTGAGAGAATTAGG - Intergenic
1026013878 7:66657220-66657242 TCCAGAGTATACAGTGTATTAGG + Intronic
1027570608 7:79861244-79861266 GGCAGAATATTCAAGCCATTGGG - Intergenic
1029047038 7:97640594-97640616 TCCAGAAACTTCAGGGTAATAGG - Intergenic
1031311384 7:120201958-120201980 TCCAGAAACTTCAGGGCAAAGGG + Intergenic
1031393304 7:121242399-121242421 TTCAGAATATTCCTAGCATTTGG + Intronic
1033716399 7:144007362-144007384 GCCGGAAGTTTCAGGGCATTTGG + Intergenic
1035455180 7:159003984-159004006 TCCAGAATATTCTGAGAAGTGGG + Intergenic
1036504770 8:9345299-9345321 TGCATAAAATTCCGGGCATTGGG - Intergenic
1039974831 8:42353652-42353674 TACAGCATATCCATGGCATTTGG + Intronic
1043166862 8:76913485-76913507 TACATAATATTAAGGCCATTTGG - Intergenic
1044649785 8:94481979-94482001 TCCAGGATACTCAGGGCATATGG - Intergenic
1045782666 8:105886107-105886129 TCCAGAAAATTCATGGGATAGGG + Intergenic
1045799821 8:106089262-106089284 TCCAGATTATTCAGATGATTAGG + Intergenic
1047705526 8:127495507-127495529 CTGAGAATGTTCAGGGCATTCGG - Intergenic
1047705780 8:127498115-127498137 TCCAGAATATTCAGAAAATGGGG - Intergenic
1048257468 8:132915929-132915951 TGAAGAAAATTCAGGGCTTTTGG - Intronic
1051606349 9:18921142-18921164 TCCAGAATAATAAGGGAATAGGG - Intergenic
1053309633 9:37008816-37008838 ACCAGAAAACTCATGGCATTTGG + Intronic
1057138532 9:92712620-92712642 TCCAGAATTTTCTGGGTTTTAGG - Exonic
1058088475 9:100777145-100777167 ACCATCATATTCAGAGCATTTGG + Intergenic
1058435529 9:104959112-104959134 ACCAGAATATTCAGGGAATGGGG + Intergenic
1058587632 9:106527697-106527719 TCAATAAAATTCAGTGCATTTGG - Intergenic
1059901071 9:118926407-118926429 TGCACAGTATTCAGGGAATTGGG + Intergenic
1061055904 9:128222839-128222861 TCAAGAATATCCATGGCATTAGG + Exonic
1061061407 9:128252240-128252262 TTCAGATTCTTCAGGGTATTTGG + Intronic
1186413523 X:9363724-9363746 TCCAGATTGCTCAGGACATTGGG + Intergenic
1186843602 X:13509305-13509327 TCCAGAACAGTTAGGCCATTAGG + Intergenic
1188856490 X:35202385-35202407 TCCAGAACATTCCTGGAATTTGG - Intergenic
1189775019 X:44462775-44462797 TCCAGAATCTTCATTCCATTTGG - Intergenic
1193092135 X:77505314-77505336 TACAAAATATTCAGCTCATTTGG + Exonic
1194394694 X:93367790-93367812 TCAAGATTATTTAGGGTATTTGG + Intergenic
1196031479 X:111098435-111098457 ACCAGAGAATTCAGGGCTTTTGG - Intronic
1196783421 X:119402203-119402225 TCCAGAATGTTCAGGGAATGGGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200687398 Y:6268586-6268608 TCCAGGACATTAACGGCATTGGG + Intergenic
1200830798 Y:7687524-7687546 TCCAGAACATTCAGGCCATTGGG - Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1201047875 Y:9906124-9906146 TCCAGGACATTAACGGCATTGGG - Intergenic