ID: 1137315219

View in Genome Browser
Species Human (GRCh38)
Location 16:47312329-47312351
Sequence AGTCACCTGCTTAGAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137315219_1137315224 29 Left 1137315219 16:47312329-47312351 CCTTTCCTTCTAAGCAGGTGACT 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1137315224 16:47312381-47312403 TAAAGATGGTTTCTTGAAAAGGG 0: 1
1: 0
2: 0
3: 52
4: 427
1137315219_1137315223 28 Left 1137315219 16:47312329-47312351 CCTTTCCTTCTAAGCAGGTGACT 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1137315223 16:47312380-47312402 TTAAAGATGGTTTCTTGAAAAGG 0: 1
1: 0
2: 1
3: 59
4: 419
1137315219_1137315222 15 Left 1137315219 16:47312329-47312351 CCTTTCCTTCTAAGCAGGTGACT 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1137315222 16:47312367-47312389 AAGTCAAATTATATTAAAGATGG 0: 1
1: 0
2: 4
3: 41
4: 533
1137315219_1137315225 30 Left 1137315219 16:47312329-47312351 CCTTTCCTTCTAAGCAGGTGACT 0: 1
1: 0
2: 0
3: 17
4: 175
Right 1137315225 16:47312382-47312404 AAAGATGGTTTCTTGAAAAGGGG 0: 1
1: 0
2: 1
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137315219 Original CRISPR AGTCACCTGCTTAGAAGGAA AGG (reversed) Intronic
900671332 1:3856883-3856905 AGGTACCTGCTTAGAGGGAAGGG + Exonic
900829597 1:4956496-4956518 AGTCATCTGCCTTGAAGGCAAGG + Intergenic
901227414 1:7621804-7621826 AGTGACCTTCTTGGAAGCAATGG - Intronic
901900661 1:12359016-12359038 AGTGACCTGCCTAGATGCAAAGG + Intronic
902849811 1:19145925-19145947 TTTCTCCTGCTTAGAAGGAATGG - Exonic
904052806 1:27650356-27650378 TGTCAGCTGCTTGGCAGGAAAGG - Intergenic
904078366 1:27856724-27856746 GGCCACCTGCTGAGAAGGGAAGG + Intergenic
904950538 1:34234796-34234818 AGGCACCAGCTTAGAAGGACAGG + Intergenic
906621183 1:47280916-47280938 AGCCACCTGCCTATAAGAAAGGG - Exonic
908939436 1:69413663-69413685 ACTCTCCTGCTTAGAATGACTGG + Intergenic
910984415 1:92991769-92991791 AGTGACCTGCTTTGAAGCAGAGG - Intergenic
913411391 1:118555797-118555819 AGTGACCTGCTGAGAAAGTATGG - Intergenic
915527081 1:156482635-156482657 AGTCACCTGCAGAGAAGGATGGG + Exonic
915656910 1:157368309-157368331 AGGCACCTGATTCTAAGGAAAGG - Intergenic
917064486 1:171076743-171076765 AGTCATCTGCTGAGAATGAGTGG - Intergenic
917274319 1:173315248-173315270 AGTCACATGCATAGAATGGATGG + Intergenic
918198801 1:182247711-182247733 AGCCACCTGCTTAGCCTGAAAGG + Intergenic
918928731 1:190824213-190824235 AGTCACCTGACAAAAAGGAAAGG + Intergenic
919030358 1:192234604-192234626 ACTCATGTGCTCAGAAGGAAGGG - Intergenic
920009107 1:202854953-202854975 AGGCTCCTGCTCAGAAGGGAAGG - Intergenic
920108620 1:203571817-203571839 AGTCTCCTGCTTTCTAGGAATGG + Intergenic
921175090 1:212586321-212586343 ATTCACCAGCTTAGCAGAAAGGG - Intronic
922607648 1:226900517-226900539 GGTCACCCGCTGAGAAGGAAGGG + Intronic
923405778 1:233657899-233657921 ACTCACCAGCTTAGAGAGAATGG + Intronic
923515605 1:234695591-234695613 AGTCACCTGCATAGGGGAAAAGG - Intergenic
924718645 1:246602619-246602641 AGTAACCTGCTTCTAATGAAAGG - Intronic
1064875242 10:19986736-19986758 AGTATACTGCTTATAAGGAATGG - Intronic
1064883677 10:20085425-20085447 AGTAACCTGGTTAGAAGGTGAGG + Intronic
1066981642 10:42422165-42422187 GGTCAGCAGCTTAGCAGGAAAGG - Intergenic
1069116500 10:64513365-64513387 AGTAATCTGCCTAGAAGGCAGGG - Intergenic
1075673062 10:124277349-124277371 AGTTTCCAGCTTATAAGGAATGG + Intergenic
1076177557 10:128379822-128379844 AGTCCCCTTCTATGAAGGAATGG + Intergenic
1076796795 10:132802307-132802329 AGACACCTCCATAAAAGGAAAGG - Intergenic
1077443404 11:2579070-2579092 AGTCATTTGCCCAGAAGGAAGGG - Intronic
1081604580 11:44519480-44519502 ATTCACGTCCTTATAAGGAAAGG - Intergenic
1084392031 11:68883568-68883590 AGGCACCTACTGAGATGGAATGG + Intergenic
1086041601 11:82486168-82486190 AGGCTCCTGCTTAGAGGGAATGG + Intergenic
1086257885 11:84901292-84901314 GGTCACAGGCTGAGAAGGAAGGG + Intronic
1086367092 11:86118389-86118411 TGTCACTTGTCTAGAAGGAAAGG - Intergenic
1087272518 11:96125879-96125901 ATTTACCTGCTGAGAAGCAAAGG + Intronic
1087274520 11:96147714-96147736 AGTAAACTGGTTATAAGGAAAGG + Intronic
1089662539 11:119994694-119994716 AGTCACCAGTTTTGGAGGAATGG - Intergenic
1089732824 11:120530013-120530035 AGTGGCCTGCTTAGGAGTAAGGG + Intronic
1090512363 11:127389092-127389114 ATTCTCCTCCTTAGAAAGAAGGG + Intergenic
1091501095 12:1018788-1018810 AATCACCTCCTTAAAAGTAAAGG - Intronic
1091722394 12:2822895-2822917 GGTCACCTGCACAGAAGGCACGG - Exonic
1096123387 12:49103021-49103043 AGTAACCAGGCTAGAAGGAAAGG - Intronic
1096965805 12:55626578-55626600 AGTGACCTGCTTTTAATGAAGGG - Intergenic
1099020734 12:77401066-77401088 AGTCTCCTGGGTAGCAGGAATGG + Intergenic
1099727299 12:86448250-86448272 AGGCAAGTGCTGAGAAGGAAAGG - Intronic
1101621370 12:106391951-106391973 AGTCAGCTTCTTAGAAGTGAGGG - Intronic
1111964275 13:94845594-94845616 AGACCCCTGCTGAGAAGGGAAGG + Intergenic
1113579556 13:111419370-111419392 AATCACCTGTTTTGAAGGGATGG - Intergenic
1113790969 13:113027936-113027958 TGTCACCTGCACAGGAGGAAGGG + Intronic
1115799568 14:36977283-36977305 AGTCTCCTTCATAGCAGGAAGGG - Intronic
1116124973 14:40772499-40772521 AGCCACCTGCTTAAATGTAATGG + Intergenic
1116269433 14:42742207-42742229 AATCAGCTGCCTTGAAGGAAAGG + Intergenic
1117445268 14:55798229-55798251 ACACAACTGCTTAGAAAGAAAGG + Intergenic
1119806008 14:77482768-77482790 AGACAGCTGGTTTGAAGGAAAGG - Intronic
1125334775 15:38616477-38616499 AGTCACTTGCTTAGAGGGTGGGG + Intergenic
1126369105 15:47926984-47927006 GGTCACCAGCATAGAAAGAATGG + Intergenic
1135718435 16:24793428-24793450 AGTCATCAGCATAGAAGGTAAGG - Intronic
1137315219 16:47312329-47312351 AGTCACCTGCTTAGAAGGAAAGG - Intronic
1137737098 16:50732841-50732863 AGACATTTGCTTTGAAGGAACGG - Exonic
1138653358 16:58474487-58474509 AGCCACCTGCTGAGAAGGGGAGG - Intronic
1138916526 16:61471453-61471475 AACCAGCTGCTTTGAAGGAAAGG + Intergenic
1141014619 16:80437435-80437457 AGTCACCTACTTTGAAGACATGG + Intergenic
1142890218 17:2938360-2938382 GGTCCCCAGCTTGGAAGGAAAGG - Intronic
1144262735 17:13538656-13538678 CATCATCTGCTTGGAAGGAAAGG + Intronic
1146224354 17:31052745-31052767 AGACACCTTCTATGAAGGAAAGG + Intergenic
1149146194 17:53496548-53496570 AGTCACCTCATTAGAACAAAAGG - Intergenic
1149451371 17:56752366-56752388 CCTCCCCTGCATAGAAGGAAGGG + Intergenic
1151225295 17:72643303-72643325 AGTCACCTATTTAGAAGGTAGGG - Intergenic
1151773873 17:76184663-76184685 AATCACCAGCTTAGAATGAATGG + Intronic
1155466270 18:26139088-26139110 AGTGACTTGCTTTTAAGGAATGG + Intronic
1155614024 18:27700843-27700865 AGTCACCTCGTTAGAATAAAAGG + Intergenic
1156108700 18:33697062-33697084 CCTCACCCTCTTAGAAGGAAAGG + Intronic
1156859934 18:41824190-41824212 AGTCTGCTGGTTAGAGGGAATGG + Intergenic
1158091102 18:53714712-53714734 AGTCACCTGCTTGGAAACAGCGG + Intergenic
1158669289 18:59460582-59460604 AGTCCTCTGCTTAGAAGGTGTGG + Intronic
1158770350 18:60508730-60508752 AATCACCTTCTTTGAAGCAAAGG - Intergenic
1158791638 18:60786884-60786906 AATCACATGCTGAGAAGGAGTGG + Intergenic
1161750560 19:6093044-6093066 AGTCACCTTTATAGTAGGAATGG + Intronic
1163051196 19:14685397-14685419 AGTCAACAGCAGAGAAGGAAGGG + Intronic
1165531502 19:36405667-36405689 AGCATCCTGCTTAGAAGAAAAGG + Exonic
1167318453 19:48780459-48780481 AGTCACCTCATTAGAAAAAAAGG - Intergenic
1167451344 19:49571633-49571655 TGTCACCTAGTTAAAAGGAATGG - Intronic
925824532 2:7834395-7834417 AGCTACCTGCTTAGCTGGAATGG + Intergenic
926982562 2:18586825-18586847 AGGCAGCTGCTGAAAAGGAATGG + Intronic
928206033 2:29284262-29284284 AGTCATCTGCATAGAGGTAAGGG + Intronic
928261410 2:29770261-29770283 AGTTACCTGCTTAGAGGTATAGG - Intronic
930012002 2:46944497-46944519 AGCCTCCTGACTAGAAGGAAGGG + Intronic
930765777 2:55083970-55083992 AGTCACCTCATTAGAACAAAAGG - Intronic
930874288 2:56196593-56196615 AGTTACCTGTTTAAAAGCAAAGG - Intronic
931029397 2:58155489-58155511 AGTCTCCTGGTGGGAAGGAAGGG + Intronic
932454692 2:71841785-71841807 AGTCACCTGCTTAGAGGTGGAGG - Intergenic
934706562 2:96485593-96485615 AGTCCCTTCCTTTGAAGGAATGG - Intergenic
935447759 2:103174806-103174828 GGTCATAGGCTTAGAAGGAAAGG - Intergenic
937885689 2:126898681-126898703 AGTCACATGCTCAGCAGGGAAGG - Intergenic
940028865 2:149239146-149239168 AGTCATCTGTTTAGAATGATGGG + Intergenic
940240889 2:151562084-151562106 AGCCACCTTCCTAGAAGGACTGG - Intronic
942202380 2:173584227-173584249 AGTTACATGCTTAAAAGTAATGG + Intergenic
942389771 2:175479761-175479783 AGTCACCAGCTCAGAGGGGAGGG - Intergenic
942673670 2:178404136-178404158 AGTTATCAGCTTAGAGGGAAGGG + Intergenic
944157568 2:196623412-196623434 AGTCCTCTGGTTAGAAGGATGGG - Intergenic
944237697 2:197455233-197455255 ATTCACCTCTTTAGAAGCAAAGG + Intronic
948104574 2:235403053-235403075 AGTCACTTCCTTAAAAGAAAAGG - Intergenic
948265756 2:236634208-236634230 TGTCACCTGCTTAGAGGAACAGG - Intergenic
948932794 2:241142875-241142897 AGACACCTGAGCAGAAGGAATGG - Exonic
1169187710 20:3632587-3632609 TGTCACCTTCTGAGAAAGAAAGG + Intronic
1169367604 20:5003562-5003584 AGTCTTCTGATTAGAAGGGAAGG + Intronic
1172670539 20:36632023-36632045 GGCCACCTGCTTAGAAGTAGAGG - Intronic
1173405902 20:42764509-42764531 AGCCTCCTGTATAGAAGGAAAGG + Intronic
1179969854 21:44829566-44829588 AGTCCTCTGGTTACAAGGAAGGG - Intergenic
1181620859 22:24090243-24090265 AGCCACCTGCCAAGAAAGAAAGG - Intronic
1181971876 22:26697135-26697157 TGTCCTCTGCTTAGAAGGAAAGG + Intergenic
1182263875 22:29096987-29097009 AGTAACTGGCTTAGAAGGGAAGG + Intronic
1182439237 22:30352455-30352477 AGTCACCTCCTCAGATGGCATGG - Intronic
1182481117 22:30609413-30609435 AGCAACCTCCTTAGAAGGAAGGG - Intronic
1184494432 22:44829435-44829457 AGGCACCTGCTCAGAATGCAGGG - Intronic
952255585 3:31692564-31692586 AGTCACCTGCTCAGAGAAAAAGG + Intronic
954239074 3:49279301-49279323 AGCCACCTGCCTAGATGCAATGG - Intronic
960264597 3:115605960-115605982 AGTCATCTGCTGAGAATAAAGGG + Intergenic
960611126 3:119555657-119555679 AGCCACGTGCTTTGAAGGCAGGG - Intronic
963847120 3:150170842-150170864 AGTCACATGCTTAGAACCCAAGG - Intergenic
966273733 3:178140562-178140584 AGTCACTTGCTTATGGGGAATGG + Intergenic
966307879 3:178557236-178557258 AGTCACTTACTTAGAAGAACTGG + Intronic
969629007 4:8324479-8324501 GCTCACCTGCCCAGAAGGAAGGG - Intergenic
971237734 4:24857843-24857865 AGTCACCTGCTTTGAAGCAGTGG - Intronic
973218347 4:47697313-47697335 ACTCACCTCCTCAGAAGGCAGGG - Intronic
973854654 4:54998992-54999014 AGCCAGCTGCTGAGAAGTAAAGG - Intergenic
975260194 4:72288841-72288863 AGTGACCTGCGGTGAAGGAACGG - Exonic
975340287 4:73232183-73232205 AGCCACGTCTTTAGAAGGAAGGG + Intronic
975861473 4:78681828-78681850 AGTGCCCTGCTTTGAAGGACAGG + Intergenic
977744966 4:100535698-100535720 AGCCTACTGCTTTGAAGGAAAGG + Intronic
978106376 4:104906581-104906603 GGTCATCTGCTTAGAATGAGGGG - Intergenic
982141436 4:152323747-152323769 AGTCACGTGCTTAACTGGAATGG - Intronic
982184744 4:152784421-152784443 AGACAAAGGCTTAGAAGGAATGG - Intronic
984670926 4:182486434-182486456 AGACACCTCCTTTGTAGGAATGG + Intronic
985081677 4:186271631-186271653 GGACACCTGCTTTGAAGGAGGGG + Exonic
986357427 5:6942526-6942548 GGGCACCATCTTAGAAGGAATGG + Intergenic
987289246 5:16492568-16492590 AGTCACTAGCTGAGAATGAAAGG - Intronic
988502515 5:31795277-31795299 AGTCACCTACTGAGAATGCATGG + Intronic
990066660 5:51724545-51724567 AATCACCTGCCTAGAAAAAATGG - Intergenic
991629325 5:68639060-68639082 AGTGACCTGCTTCTAAAGAATGG - Intergenic
994215329 5:97131308-97131330 AGTAAGCTGGATAGAAGGAAGGG - Intronic
995928234 5:117401998-117402020 AATCACCAGCTCAGAAGCAATGG - Intergenic
997027598 5:130084013-130084035 AGTTATCTGATTAAAAGGAAGGG - Intronic
997249702 5:132379054-132379076 AATAACCTGCTTATAAGAAATGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997727938 5:136137823-136137845 AGTTCCCTGCTTAGTAGAAAAGG - Intronic
1003496400 6:6667442-6667464 AGACACCACCTTGGAAGGAATGG - Intergenic
1003993559 6:11513790-11513812 ATTCAACAACTTAGAAGGAATGG + Intergenic
1004788829 6:19000333-19000355 AGTGACCTGCCTAAAAGGAGAGG - Intergenic
1010144193 6:72647223-72647245 AGTCACCTGCCTACACGGCAAGG - Intronic
1010149719 6:72717225-72717247 AATGACCTGCTTAAAAGGAATGG + Intronic
1012258601 6:97061756-97061778 TGTCACCTGCCTCGAAGGACTGG - Intronic
1016592630 6:145763393-145763415 GGGTACCTGCTTAGAATGAAAGG + Intergenic
1016689443 6:146919631-146919653 AATCAACAGTTTAGAAGGAAGGG + Intergenic
1019730926 7:2629154-2629176 CGTCACCTTCTTTGAAGAAAGGG - Intergenic
1021139872 7:17010968-17010990 AGTCCCCTGCTTCAAGGGAATGG + Intergenic
1022175228 7:27865913-27865935 AGTCACCTGCTCAGAAAGCAAGG - Intronic
1026234148 7:68511235-68511257 GGTCTCCTGCTTTGAAGGGAAGG + Intergenic
1029553190 7:101249395-101249417 AGTCACTTCATTAGAAGAAAAGG - Intronic
1029811523 7:103053954-103053976 AGGCATCTGTTTAGAAGGATGGG - Intronic
1030371354 7:108702892-108702914 TGACACCTGCTCAGAAGGTAGGG - Intergenic
1031192504 7:118571909-118571931 AGTCACATGAAAAGAAGGAAAGG - Intergenic
1033275789 7:139970891-139970913 AGCCCCCTGCTTAAAAGGATTGG - Intronic
1033305118 7:140219550-140219572 AGTCATCTGCCTAGAGGGAAAGG + Intergenic
1033436934 7:141341699-141341721 AGTCATTTACTTAGAAGAAATGG + Intronic
1033568472 7:142602628-142602650 ATCCACATGTTTAGAAGGAAGGG + Intergenic
1035550424 8:519402-519424 AGTCAGCTGAGTAGAAGCAAGGG + Intronic
1044672181 8:94693488-94693510 AGCTATCTGCTTAGATGGAATGG - Intronic
1045135955 8:99218708-99218730 AGTCAGCTGATCAGAATGAATGG + Intronic
1047324246 8:123821136-123821158 AGTCACCTCCCTAGAGGGAAAGG - Intergenic
1047617660 8:126576313-126576335 AGTCCCCTGACTAGAAGCAAGGG - Intergenic
1048290544 8:133178171-133178193 AGGCATCTGATTTGAAGGAAAGG - Intergenic
1048496934 8:134943097-134943119 TGTCTCCTGCTTATAAGGCATGG + Intergenic
1049140166 8:140947229-140947251 AGTCATCTCCTAAGAAGGAGTGG - Intronic
1050316106 9:4402061-4402083 ACTCACCGTCTTAAAAGGAAAGG + Intergenic
1050456710 9:5841461-5841483 AATCAACTGCTTAAAAGGTATGG + Intergenic
1051146875 9:14036117-14036139 AGTCACCTGTGAACAAGGAATGG - Intergenic
1051805694 9:20990386-20990408 AGCCACCTGCTTAGCAGGGCAGG + Intronic
1055574718 9:77648996-77649018 AGACACCTGCTTTGTAGAAAGGG + Intergenic
1058626604 9:106939868-106939890 AATCAGCTGCTTAGAAGAGAAGG + Intronic
1060411396 9:123402828-123402850 AGTCACCTGCTCAGGAGGCGTGG - Intronic
1062181591 9:135193934-135193956 AGTCACTTGTTTGGAAAGAAAGG - Intergenic
1187548924 X:20281835-20281857 AGTCACCTCATTAGAACAAAAGG - Intergenic
1187551564 X:20310981-20311003 AATGTCCTGCTTAGAAAGAAAGG - Intergenic
1191921585 X:66262423-66262445 AGTCATCTGCTGAGAATGAAAGG + Intronic
1193313232 X:80033045-80033067 AGTCACTTACTTAGAAGCAGGGG - Intergenic
1195382435 X:104283508-104283530 AGTCACCTGCATGGCTGGAAGGG + Intergenic
1197723042 X:129757978-129758000 AGTCACACGTTTGGAAGGAATGG - Intronic