ID: 1137317100

View in Genome Browser
Species Human (GRCh38)
Location 16:47337050-47337072
Sequence CAGGAGAATCACAGGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3026
Summary {0: 1, 1: 0, 2: 4, 3: 112, 4: 2909}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137317094_1137317100 -1 Left 1137317094 16:47337028-47337050 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG 0: 1
1: 0
2: 4
3: 112
4: 2909
1137317088_1137317100 18 Left 1137317088 16:47337009-47337031 CCTGTGGGCACATGTAATCCCAG 0: 1
1: 2
2: 13
3: 49
4: 232
Right 1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG 0: 1
1: 0
2: 4
3: 112
4: 2909
1137317092_1137317100 0 Left 1137317092 16:47337027-47337049 CCCAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG 0: 1
1: 0
2: 4
3: 112
4: 2909

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137317100 Original CRISPR CAGGAGAATCACAGGGAGGC GGG Intronic
Too many off-targets to display for this crispr