ID: 1137319451

View in Genome Browser
Species Human (GRCh38)
Location 16:47365196-47365218
Sequence CACTGAACAGCTTTTAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137319443_1137319451 26 Left 1137319443 16:47365147-47365169 CCTACGGTGGTTTATTGGCATAA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1137319451 16:47365196-47365218 CACTGAACAGCTTTTAGGTGGGG 0: 1
1: 0
2: 2
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137319451 Original CRISPR CACTGAACAGCTTTTAGGTG GGG Intronic