ID: 1137321105

View in Genome Browser
Species Human (GRCh38)
Location 16:47383527-47383549
Sequence TTGGATAGTAGCGCTTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137321105_1137321108 6 Left 1137321105 16:47383527-47383549 CCTACACAAGCGCTACTATCCAA 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1137321108 16:47383556-47383578 TTTTTTTAGCAGCTGAAACATGG 0: 1
1: 0
2: 0
3: 31
4: 436
1137321105_1137321109 14 Left 1137321105 16:47383527-47383549 CCTACACAAGCGCTACTATCCAA 0: 1
1: 0
2: 0
3: 5
4: 35
Right 1137321109 16:47383564-47383586 GCAGCTGAAACATGGCATGCTGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137321105 Original CRISPR TTGGATAGTAGCGCTTGTGT AGG (reversed) Intronic
905461816 1:38127148-38127170 TGGGATAGAAGAGCATGTGTGGG - Intergenic
905641852 1:39595444-39595466 TTGGAGGGCAGGGCTTGTGTGGG + Intergenic
911090659 1:94014484-94014506 TAGGATAGTAGAGTATGTGTTGG - Intronic
1067184095 10:44012489-44012511 TTGGATAGCAGGGCGTGTGTGGG + Intergenic
1068140225 10:52996449-52996471 TTGGTCAGTAGGGCTGGTGTTGG - Intergenic
1071991770 10:91106661-91106683 TTGGATATTAGACCTTCTGTAGG + Intergenic
1074085944 10:110209020-110209042 GTGGATAGTAGTGCGTGGGTGGG + Intronic
1074797886 10:116967309-116967331 TTGGAAAGTACAGCTTTTGTGGG + Intronic
1080258257 11:30317628-30317650 GTGTATAGTTGCCCTTGTGTGGG - Intergenic
1095925056 12:47570095-47570117 ATGGAAAGTAGTGCTTTTGTTGG - Intergenic
1098976434 12:76906991-76907013 TTGGATAGATGTGCATGTGTAGG - Intergenic
1105845299 13:24288926-24288948 TTGAATAGTACAGCTTTTGTAGG - Intronic
1125386978 15:39148034-39148056 TTGGTTAGTAGGGCCTCTGTGGG + Intergenic
1130003370 15:80067668-80067690 GTGGCTAGTGGCGATTGTGTTGG + Intronic
1137321105 16:47383527-47383549 TTGGATAGTAGCGCTTGTGTAGG - Intronic
1139962423 16:70725552-70725574 TTGCATAAGAGCCCTTGTGTTGG - Intronic
1154398895 18:14016297-14016319 TTGGAGATTAACCCTTGTGTGGG + Intergenic
1168718634 19:58542851-58542873 GTGGAAAGTAGGGTTTGTGTGGG - Intergenic
930116546 2:47723133-47723155 TTGGGTAGTAGGGCTTGGATAGG - Intronic
930281971 2:49379865-49379887 TTGGAGGGTAGGGCTAGTGTAGG + Intergenic
931396916 2:61895854-61895876 TTGGTCAGTAGGGCTGGTGTTGG - Intronic
943003648 2:182361980-182362002 TAGGATAGTAACGATTCTGTGGG - Intronic
946781812 2:223199126-223199148 TTGTATAGTAGCTCTTTTTTTGG - Intergenic
1173085458 20:39911874-39911896 TTGGAGAGGAGCACTTGTATTGG + Intergenic
949142375 3:650393-650415 TTGCAAAGAAGAGCTTGTGTGGG - Intergenic
949679304 3:6494646-6494668 TTGGATAGTAGCACAAGTGTCGG + Intergenic
955127505 3:56128135-56128157 ATGAATAGGAGAGCTTGTGTTGG - Intronic
963196180 3:142532970-142532992 GTGGATAGTAGCTATTGTATTGG - Intronic
969869857 4:10097850-10097872 TGGGATAGTGGCTCTTCTGTGGG - Exonic
983035921 4:162865431-162865453 ATGGATAGTAGCACTTGTTCTGG - Intergenic
986174319 5:5339082-5339104 TTGGATAGTAGAGCCTGTTTTGG - Intergenic
989741258 5:44775295-44775317 TTGGATAGTAGCCCTATTTTTGG + Intergenic
991137442 5:63198670-63198692 ATGAATAGTAGCCCTTGTGTAGG - Intergenic
998663865 5:144273281-144273303 TTTGATAGTAGCCATTGTGTTGG - Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1007921742 6:45616501-45616523 ATGGATGGGAGCTCTTGTGTAGG - Intronic
1024378976 7:48672477-48672499 TTGGATGGTGGCCCTTGGGTTGG + Intergenic
1032958400 7:137000750-137000772 ATGCATTGTAGTGCTTGTGTTGG - Intronic
1037408837 8:18572435-18572457 TTGGATAGTAGTCCATGTTTTGG - Intronic
1037966449 8:23137753-23137775 TTGGATAGTAGAGTTTGTTGGGG + Exonic
1038357194 8:26840297-26840319 TGGGAAAGTAGCGGTTGGGTAGG + Intronic