ID: 1137330666

View in Genome Browser
Species Human (GRCh38)
Location 16:47492408-47492430
Sequence CTGCTGATCTGGTGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 1, 2: 1, 3: 63, 4: 624}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137330662_1137330666 27 Left 1137330662 16:47492358-47492380 CCTAGTTAAAATGTCTTCTAAAA 0: 1
1: 1
2: 15
3: 134
4: 887
Right 1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG 0: 1
1: 1
2: 1
3: 63
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137330666 Original CRISPR CTGCTGATCTGGTGGAGAAA AGG Intronic
901764999 1:11494388-11494410 CTGGAGATGTGGTGGTGAAACGG - Intronic
901841276 1:11955467-11955489 TTGCTGATTTTGTGGATAAATGG + Intronic
902552244 1:17225983-17226005 CTGTTGGTGGGGTGGAGAAAGGG + Intronic
903298492 1:22361291-22361313 CTGCTGAGCTAGTGGAGAGACGG + Intergenic
903299370 1:22367381-22367403 CTGCTGGGGTTGTGGAGAAAAGG + Intergenic
904890515 1:33776210-33776232 CTGAAGATGTGGAGGAGAAAGGG + Intronic
905688590 1:39926511-39926533 CTGCTGATGTGGAGGAGAGATGG - Intergenic
905786156 1:40759360-40759382 CTGATGTTCTGGTGGAGACAAGG - Intronic
907014579 1:50999386-50999408 CTGGTGATGATGTGGAGAAAAGG + Intergenic
907346044 1:53781376-53781398 CTGCAAATATGTTGGAGAAATGG + Intronic
907612948 1:55890846-55890868 CTGTTGAGGTTGTGGAGAAAAGG - Intergenic
907982231 1:59494986-59495008 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
908285251 1:62590850-62590872 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
908819794 1:68073529-68073551 CTGCTGAGGTGGCAGAGAAAAGG - Intergenic
908935744 1:69373829-69373851 ATGGTGATGTGGTGGAGAAGGGG + Intergenic
909125233 1:71659832-71659854 CTGATGATGTTGTGGAGAAAAGG + Intronic
909126329 1:71675368-71675390 TTGCTGATCTAGTGGTGAATGGG - Intronic
909181016 1:72424128-72424150 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
909354735 1:74695844-74695866 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
909579496 1:77218500-77218522 CAGCACATCTGGTTGAGAAATGG + Intronic
910328172 1:86035562-86035584 CTGGTGATGTGGGGGAGGAATGG + Intronic
910489210 1:87749646-87749668 CTGCTGGTCTTGTAGGGAAATGG - Intergenic
910512263 1:88020569-88020591 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
910629076 1:89338271-89338293 TTCCTGACATGGTGGAGAAAAGG - Intergenic
911393548 1:97276713-97276735 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
911910579 1:103629144-103629166 CTGGTGAGGAGGTGGAGAAAAGG + Intergenic
911917995 1:103723269-103723291 CTGGTGAGGAGGTGGAGAAAAGG + Intronic
912111518 1:106348629-106348651 CTGCTGATGAGATAGAGAAAGGG + Intergenic
912589730 1:110804525-110804547 CTGATGATGTTGTAGAGAAAAGG - Intergenic
912600623 1:110929398-110929420 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
912769784 1:112452950-112452972 CTGCTGATTTTTTGTAGAAATGG - Intronic
913030886 1:114901843-114901865 CTGCTGACAAGGTAGAGAAAAGG + Intronic
913103143 1:115587934-115587956 CTGCTGACAGGGTAGAGAAAAGG - Intergenic
915672323 1:157499888-157499910 CTGCTGATAGGGTAGAGAAGAGG - Intergenic
916599097 1:166275402-166275424 CTGGTGAGGTTGTGGAGAAATGG - Intergenic
917209507 1:172616901-172616923 CTCTTGACCTGGTGGAGAAAAGG - Intergenic
917228719 1:172813265-172813287 CTCTTGATATGGTGGAGAAGTGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917408021 1:174729826-174729848 CTGGTGATGCTGTGGAGAAAAGG + Intronic
917429847 1:174954720-174954742 CTTCCGATCTGGTGGGAAAATGG + Intronic
918175436 1:182040451-182040473 CTGCTGACAGGGTAGAGAAAAGG + Intergenic
918669280 1:187194227-187194249 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
918704367 1:187641850-187641872 ATGCTGATATTGTGGAGAAGAGG - Intergenic
918788768 1:188798939-188798961 CTGCTATTCTGTTGGAGATAAGG - Intergenic
919576744 1:199319524-199319546 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
919629686 1:199948149-199948171 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
919762165 1:201105058-201105080 CTGCTGATTTGCTGGAGGACTGG + Intronic
921298870 1:213730405-213730427 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
921563083 1:216681802-216681824 TTGCTGCTGTGGGGGAGAAAAGG + Intronic
921673360 1:217950923-217950945 CTGTTGATCTGGTGGAGCAGTGG + Intergenic
922079470 1:222281180-222281202 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
922339505 1:224644099-224644121 CTGCTGAGGTGCTGGAGCAAGGG - Intronic
922390152 1:225132860-225132882 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
922568196 1:226615867-226615889 CTGCTGATGGGGCGGAGAAGAGG + Intergenic
922877674 1:228952990-228953012 CTGGTGATATTGTGGAGAAAGGG - Intergenic
923179620 1:231503637-231503659 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
924900865 1:248397695-248397717 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1063621115 10:7650176-7650198 CTGGAAATGTGGTGGAGAAATGG + Intronic
1063893770 10:10657244-10657266 CTTATGATTTGCTGGAGAAAAGG + Intergenic
1064417963 10:15167689-15167711 TTGCTCTTCTGTTGGAGAAAAGG - Intronic
1064688686 10:17891622-17891644 CTGCTGACGTAGTGGATAAAGGG + Intronic
1064889253 10:20150357-20150379 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1064891077 10:20174545-20174567 CTGCAGAAGGGGTGGAGAAAGGG - Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065150755 10:22820596-22820618 GTGCTGATCTTGTGGAGACACGG + Intergenic
1066490959 10:35894240-35894262 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1066524345 10:36260109-36260131 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1067043833 10:42973543-42973565 CTGCTGATGTCTTGGAGACAGGG - Intergenic
1069724940 10:70571493-70571515 CTGCTGCCCTGGTGGAGACCCGG + Intergenic
1072903854 10:99432542-99432564 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1073739356 10:106388880-106388902 ATGGTGATCTCATGGAGAAAGGG + Intergenic
1073903036 10:108245300-108245322 CTCCTGACATGGTGGAGAAAAGG - Intergenic
1073934032 10:108609113-108609135 CTGGTGACATTGTGGAGAAAAGG + Intergenic
1074109966 10:110415881-110415903 CTTCTGCCCTGGTGCAGAAACGG + Intergenic
1074645876 10:115451617-115451639 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1076592629 10:131596834-131596856 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1076592950 10:131601524-131601546 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1077468416 11:2745031-2745053 CTGATGCTCTGGTTTAGAAACGG + Intronic
1077975339 11:7242369-7242391 CAGCTGATCAGCTGGAGAGATGG - Intronic
1078011877 11:7578696-7578718 CTGCTGTTTTGATGGAGAAGGGG + Intronic
1078036369 11:7809715-7809737 CTGCTGAGGCTGTGGAGAAAAGG + Intergenic
1078113291 11:8418727-8418749 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1078353202 11:10612419-10612441 CTGCTTAGGTGGTGGGGAAAAGG - Intronic
1078630260 11:12996317-12996339 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
1079558031 11:21785695-21785717 CTGCTGAGGATGTGGAGAAAAGG - Intergenic
1079879956 11:25914618-25914640 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1080321538 11:31015625-31015647 CTGCTGAACATTTGGAGAAAAGG + Intronic
1080796672 11:35570435-35570457 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1080913211 11:36626731-36626753 CTGATGGTATGGTGGAGATAAGG + Intronic
1081084088 11:38777569-38777591 CTACTGAGGTTGTGGAGAAAAGG + Intergenic
1082795173 11:57373619-57373641 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1083110364 11:60400272-60400294 CTGATGCTCAGGTGGAAAAACGG + Intronic
1083529130 11:63401742-63401764 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1085365088 11:75933857-75933879 CTGGTGAGGAGGTGGAGAAAAGG + Intronic
1085398649 11:76221247-76221269 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1085914184 11:80865020-80865042 CTGATGAGATTGTGGAGAAAAGG + Intergenic
1085937689 11:81169420-81169442 CTGGTGAGGTCGTGGAGAAAAGG - Intergenic
1085939838 11:81195837-81195859 CTGGTGAGGTGGTAGAGAAAAGG - Intergenic
1086247782 11:84775281-84775303 TTGATGAGCTTGTGGAGAAAAGG + Intronic
1086619067 11:88863118-88863140 CTGGTGAGGTTGTGGAGAAATGG + Intronic
1086991550 11:93309330-93309352 GTGGTGATGTTGTGGAGAAAAGG + Intergenic
1087350515 11:97026071-97026093 CTGCTGAGAATGTGGAGAAAAGG + Intergenic
1088038169 11:105343709-105343731 ATGCTGGTGAGGTGGAGAAATGG + Intergenic
1088730278 11:112674804-112674826 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1090114805 11:123957237-123957259 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1091151577 11:133333999-133334021 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1091310613 11:134572968-134572990 CTGCTGAACGGCTGGGGAAAGGG - Intergenic
1091811528 12:3402825-3402847 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1091901824 12:4150363-4150385 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1092444791 12:8544647-8544669 TTGTTAATGTGGTGGAGAAATGG - Intergenic
1092579776 12:9826387-9826409 CTGATGAGGTAGTGGAGAAAAGG + Intergenic
1093429339 12:19066312-19066334 ATGCTGATTTGTTAGAGAAAGGG - Intergenic
1093498384 12:19782882-19782904 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1093502155 12:19825783-19825805 CTGGTAATGTTGTGGAGAAAAGG + Intergenic
1093992037 12:25600805-25600827 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1094316864 12:29145251-29145273 CTCCTGACATGGTGGAGAAAAGG + Intergenic
1095240145 12:39848530-39848552 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1095555907 12:43504194-43504216 CTGATGAGGTTGTGGAGAAAGGG - Intronic
1095680048 12:44963582-44963604 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1095683447 12:45005124-45005146 CTACTGATATGGTGGAGGTATGG - Intergenic
1095823872 12:46510734-46510756 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1095846323 12:46749191-46749213 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1096233630 12:49911215-49911237 CTTTCCATCTGGTGGAGAAACGG - Intergenic
1097304941 12:58058903-58058925 CTGCAGATCTGTTGGAGTACTGG + Intergenic
1097776457 12:63652279-63652301 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1097857189 12:64475996-64476018 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1098224929 12:68311577-68311599 CTTAGGATCTGGTGGAGATATGG - Intronic
1098842907 12:75498082-75498104 CTGCAGAACTGGTGTGGAAAAGG + Exonic
1098914329 12:76241239-76241261 CTGCTGATCAAGTGGAGAGATGG + Intergenic
1099184785 12:79504846-79504868 GTGGTGATCAGGTGGAGACAGGG - Intergenic
1099487414 12:83245655-83245677 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1099514166 12:83575999-83576021 ATACTGATATGGTAGAGAAAAGG + Intergenic
1100086565 12:90917949-90917971 ATACTGATATGGAGGAGAAAGGG - Intronic
1100242681 12:92725521-92725543 GCCCTGATCTGGTGGAGACATGG + Intronic
1101052407 12:100876555-100876577 CTGATGATGCAGTGGAGAAAGGG + Intronic
1101089707 12:101272499-101272521 CTGGTGATAATGTGGAGAAAGGG + Intergenic
1101752945 12:107598078-107598100 CTGCTTATCAGCTGGGGAAAGGG + Intronic
1101772259 12:107761802-107761824 CTGCTGTTCTGCTGGTGTAAGGG - Intergenic
1104221655 12:126790423-126790445 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1104492423 12:129206459-129206481 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1105347022 13:19582829-19582851 CTGGTGAGGAGGTGGAGAAAAGG - Intergenic
1105698937 13:22920051-22920073 CTGGTGAGGAGGTGGAGAAAAGG - Intergenic
1105850686 13:24332893-24332915 CTGGTGAGAAGGTGGAGAAAAGG - Intergenic
1107223210 13:38012094-38012116 CTGCTGATTTGAAAGAGAAAAGG + Intergenic
1107643513 13:42469923-42469945 CTGCTGAGGATGTGGAGAAAAGG + Intergenic
1108165146 13:47685336-47685358 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1108203764 13:48067381-48067403 CTGCTGACAGGGTAGAGAAAAGG - Intronic
1110482044 13:75990067-75990089 CTGGTGATATTGTGGAGAAAAGG + Intergenic
1110610574 13:77482838-77482860 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1110910315 13:80953143-80953165 CTGTTGAGGTTGTGGAGAAAGGG + Intergenic
1111132637 13:83996820-83996842 CTGCTGATGGGGTAGAGAAGGGG - Intergenic
1111161197 13:84397626-84397648 CTGATGAAGTTGTGGAGAAAAGG + Intergenic
1111221481 13:85209815-85209837 ATGCTGATTTGGTGGAGAACTGG + Intergenic
1111450813 13:88412872-88412894 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1111492017 13:88991477-88991499 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1111911802 13:94321550-94321572 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1112705940 13:102068933-102068955 CTCCTGATCTGGTGGGGACGTGG + Intronic
1113227412 13:108174598-108174620 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1113588917 13:111484524-111484546 CTGCTGAGCTGCTGGAGACAAGG - Intergenic
1115021095 14:28682712-28682734 TTGCTGAGATTGTGGAGAAAAGG - Intergenic
1115391850 14:32862751-32862773 CTGGTGAGCTTGTAGAGAAAAGG - Intergenic
1115890982 14:38028656-38028678 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1116102996 14:40465439-40465461 CTGCTGACAGGGTGGAGAAAAGG - Intergenic
1116276245 14:42836555-42836577 CTGATGATCTGTTTAAGAAAAGG + Intergenic
1116390373 14:44384123-44384145 CTGCTGATGGGGTGGAGAAGAGG + Intergenic
1116390919 14:44388346-44388368 CTGCTGATGGGGTGGAGAAGAGG + Intergenic
1117418709 14:55522697-55522719 CTGCTGAGGATGTGGAGAAAAGG + Intergenic
1117499877 14:56340978-56341000 TTGCTCATCTAGTAGAGAAATGG - Intergenic
1118950175 14:70429085-70429107 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1118999786 14:70871717-70871739 CTCCCGACCTGATGGAGAAAAGG + Intergenic
1119602805 14:75988458-75988480 ATGATGATGTGGTGGAGAACGGG - Intronic
1120480917 14:85048022-85048044 CTGTTGAGGTGGTGGAGTAAAGG - Intergenic
1121116814 14:91349455-91349477 CTGCTGTTCAGAGGGAGAAACGG + Intronic
1121237661 14:92404520-92404542 ATGCTGCTGTGTTGGAGAAAAGG - Intronic
1121492968 14:94372938-94372960 CTGCTGATCTGGGGCAGAGGAGG - Intergenic
1121513083 14:94527923-94527945 CTGGTGAAATTGTGGAGAAAAGG + Intergenic
1202832066 14_GL000009v2_random:45863-45885 CAGCTGATCAGTTGGGGAAATGG + Intergenic
1124122669 15:26903589-26903611 CTGGTGAGGTTGTGGAGAAAGGG - Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1125017652 15:34952357-34952379 CTGGTGTTCTGTTTGAGAAATGG + Intronic
1125844559 15:42839582-42839604 CTGGTGAGATGGTGGTGAAAAGG - Intronic
1126464886 15:48952774-48952796 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1129005053 15:72365964-72365986 CAGGTGGTCTGGTGGAGAAGAGG - Intronic
1129055913 15:72820386-72820408 CTGATGATTTGGTGAAGCAATGG + Intergenic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1129979645 15:79856151-79856173 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1130424499 15:83781926-83781948 CTGGTGAGATTGTGGAGAAAAGG + Intronic
1132107998 15:99078322-99078344 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1135077531 16:19407142-19407164 CTGCTGATAGGGTGGACAATAGG + Intergenic
1135861256 16:26058201-26058223 TTCCTCATCTGTTGGAGAAAGGG + Intronic
1136009293 16:27352525-27352547 ATTCTGAACTGGTAGAGAAAAGG - Exonic
1136648469 16:31644175-31644197 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1137330666 16:47492408-47492430 CTGCTGATCTGGTGGAGAAAAGG + Intronic
1137626246 16:49910571-49910593 CTGGAGTTCTGGTGGAGGAAGGG - Intergenic
1137969422 16:52969232-52969254 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1138877539 16:60970943-60970965 ATGCTGATGTGTTGGACAAAGGG - Intergenic
1141096282 16:81165333-81165355 CTGCTTGTCAGGTGGAGGAATGG + Intergenic
1141306599 16:82870322-82870344 CTGGTGAGGGGGTGGAGAAAAGG + Intronic
1141703484 16:85652807-85652829 CTGCTGATCTTGTGGGGAGACGG + Intronic
1143015214 17:3887944-3887966 CTGATGATCTTTTGGAGACAAGG - Intronic
1143710489 17:8731262-8731284 CTGCTGAGGTTGTGGAGAAAAGG + Intronic
1144079883 17:11754462-11754484 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1145301312 17:21640561-21640583 CTGCTGATTTGGAGGCGCAATGG + Intergenic
1145348989 17:22062741-22062763 CTGCTGATTTGGAGGCGCAATGG - Intergenic
1146210913 17:30942905-30942927 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1147498978 17:40943963-40943985 CTGGTGAGGTTGTGGAGAAATGG - Intergenic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1148168923 17:45503368-45503390 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1148279894 17:46339645-46339667 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1148302112 17:46557501-46557523 CTGCTGCTATGGGGGAGGAAAGG + Exonic
1148537347 17:48451282-48451304 GAGCAGATCTGGAGGAGAAAGGG - Intergenic
1149092564 17:52801714-52801736 CTGCTGATGTTGCAGAGAAAGGG - Intergenic
1149160228 17:53685013-53685035 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
1149668055 17:58380089-58380111 TTCCTCACCTGGTGGAGAAAAGG - Intronic
1149957435 17:61068403-61068425 CCAATGATCTGGTGGGGAAATGG - Intronic
1150400118 17:64849829-64849851 CTGCTGCTATGGGGGAGGAAAGG - Intergenic
1150527700 17:65940242-65940264 CTGCTGAGGATGTGGAGAAAAGG + Intronic
1150649523 17:67000794-67000816 CTGCTGACTTGGAGCAGAAAGGG - Intronic
1150849210 17:68688329-68688351 TTGCTGATCAGGTAGAGAGAGGG + Intergenic
1150894079 17:69189166-69189188 CTGATGAGGTTGTGGAGAAAAGG - Intronic
1152152097 17:78608298-78608320 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1153421701 18:4914229-4914251 CTGGTGAGCATGTGGAGAAAAGG + Intergenic
1153722328 18:7918372-7918394 CTGGTGAGCATGTGGAGAAAGGG - Intronic
1155435926 18:25813050-25813072 CTGCTGATGTGTTAAAGAAAGGG - Intergenic
1156067910 18:33167398-33167420 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1156318434 18:35994053-35994075 GTGCTGAGCTTTTGGAGAAAGGG - Intronic
1156572527 18:38274532-38274554 CTGGTGAGTTAGTGGAGAAAGGG + Intergenic
1156706036 18:39883551-39883573 CTGGTGATCTGGTGAAAAGATGG + Intergenic
1156715331 18:40002218-40002240 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
1156885800 18:42134143-42134165 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1156892156 18:42203344-42203366 CTGCTGATCTTGTGGGAAACTGG + Intergenic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157698204 18:49741698-49741720 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1157795987 18:50575998-50576020 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1158500805 18:57999577-57999599 CTGGTGAATTGGTGGAGCAATGG - Intergenic
1158749202 18:60239395-60239417 CTGTTGAAGTTGTGGAGAAAAGG - Intergenic
1159149884 18:64507286-64507308 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1159290534 18:66413090-66413112 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1159564743 18:70036056-70036078 CTGATGAGGTTGTGGAGAAAAGG + Intronic
1159573048 18:70142642-70142664 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1160280859 18:77489302-77489324 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1160423878 18:78767462-78767484 CTGCTCTTCAGGTGGAGATATGG - Intergenic
1161161452 19:2763750-2763772 CTGCGGCTCTGGGGAAGAAAAGG + Exonic
1163071179 19:14843188-14843210 CTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1163080319 19:14935253-14935275 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1164306149 19:24005002-24005024 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1165524278 19:36339971-36339993 CTGGTAATCAAGTGGAGAAAGGG + Exonic
1165674265 19:37707767-37707789 CTTCTGATGTGGAGAAGAAATGG - Intronic
1166009476 19:39931476-39931498 CTGCTGAGCATGTGGAGAAAAGG + Intronic
1166496597 19:43307287-43307309 CAGGTGATTTGATGGAGAAATGG + Intergenic
1167857186 19:52251722-52251744 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1167868967 19:52351647-52351669 CTGCAGAGCAGGTGCAGAAAGGG - Intronic
1168482135 19:56729827-56729849 CTGGTGATGCTGTGGAGAAATGG + Intergenic
1168519719 19:57039621-57039643 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1202640618 1_KI270706v1_random:81888-81910 CAGCTGATCAGTTGGGGAAATGG - Intergenic
925029909 2:642446-642468 CTTCTGAGCTGGGGCAGAAATGG - Intergenic
925722236 2:6840628-6840650 CTGCCGAGCAGGTGGAGAGAAGG + Intronic
926703045 2:15816940-15816962 CTGTTGCTGTGATGGAGAAAAGG - Intergenic
927091144 2:19713648-19713670 CTTCTGCTCTGATGCAGAAATGG + Intergenic
927651634 2:24917061-24917083 CTGCTGATTTGTTCTAGAAATGG - Intronic
928834084 2:35522512-35522534 CTGCTGACTGGGTGGAGAGAAGG + Intergenic
929267622 2:39936958-39936980 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
929362618 2:41112372-41112394 ATGATGATGTTGTGGAGAAAAGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930770556 2:55126533-55126555 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931921625 2:67023310-67023332 CTGGTGACGTTGTGGAGAAAAGG + Intergenic
932371531 2:71193069-71193091 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
932445929 2:71781521-71781543 CAGCTGCACTGGTGGAGAGAGGG + Intergenic
932630997 2:73343239-73343261 CGGCAGATCTGGTGGTGGAAAGG + Intergenic
932845097 2:75126997-75127019 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
933335474 2:80952667-80952689 CTGATGAGGTTGTGGAGAAAAGG - Intergenic
933511355 2:83245665-83245687 CCGCTAATCTGGTGGGGACATGG - Intergenic
934496181 2:94801873-94801895 CAGCTGATCAGCTGGGGAAATGG - Intergenic
934552125 2:95269003-95269025 CTGCTGATCTTGGAGAGAGAGGG + Intergenic
934738091 2:96700155-96700177 CTGCAGACTTGGGGGAGAAAGGG + Intergenic
935248858 2:101243660-101243682 CTGCTCATTTTGTGGATAAATGG + Intronic
935553079 2:104479018-104479040 CTGCTCATGTTGGGGAGAAATGG - Intergenic
936266844 2:111017410-111017432 CTGCTGAGCTTGCGCAGAAATGG - Intronic
936856374 2:116962709-116962731 TTCCTGTTCTGCTGGAGAAAGGG + Intergenic
937075757 2:119105186-119105208 CTGCCCATGTGGTGGAAAAAGGG + Intergenic
937718850 2:125066863-125066885 CTGTTGACGTTGTGGAGAAAAGG - Intergenic
939450294 2:142364901-142364923 GTGAAGATCTGGAGGAGAAATGG + Intergenic
940447326 2:153791435-153791457 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
940716245 2:157227821-157227843 CTGGTGATGATGTGGAGAAAAGG - Intergenic
941119883 2:161515982-161516004 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
941249444 2:163144219-163144241 CTGCTGATGTTGTAGGGAAAAGG - Intergenic
941536454 2:166728135-166728157 ATGCTGAGATTGTGGAGAAAAGG + Intergenic
941566091 2:167109808-167109830 CTGATGAGGTAGTGGAGAAAAGG - Intronic
941752934 2:169152408-169152430 CTGCTCATTTTGTGAAGAAATGG - Intronic
942183197 2:173400405-173400427 CTTCTGATCTGCAGGAGAATCGG - Intergenic
942440974 2:176036345-176036367 GTGATGATCAGGAGGAGAAAGGG + Intergenic
942532773 2:176929852-176929874 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
942839024 2:180337161-180337183 CTGCTGATGGGGTAGAGAAGAGG - Intergenic
943214530 2:185013243-185013265 CTGTTGATGGGGTGGAGAAGAGG - Intergenic
943353843 2:186826155-186826177 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
943419754 2:187655367-187655389 CTGCTGATGGGGTGGAGAAGAGG - Intergenic
943429044 2:187774829-187774851 CTGCTGAGGCTGTGGAGAAAAGG + Intergenic
943554410 2:189384389-189384411 CTGCTGAGGATGTGGAGAAATGG - Intergenic
943640735 2:190354830-190354852 CTGAAGATCAGCTGGAGAAAAGG + Intronic
943968181 2:194366477-194366499 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
944643791 2:201756922-201756944 CTGCTGAACTGATTGAGAAAAGG + Intronic
946130206 2:217600777-217600799 CTACTGTCCTGGTGGAGAAGAGG + Intronic
946319282 2:218941041-218941063 CTAATGATGTTGTGGAGAAAAGG - Intergenic
947438390 2:230093776-230093798 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
947946014 2:234102858-234102880 CTGGAGCTCTGGTGGAAAAAAGG + Intergenic
947983502 2:234429269-234429291 CTGCTGACTTGGAGGAGAAAGGG - Intergenic
948100344 2:235367872-235367894 GGGCTGTGCTGGTGGAGAAATGG - Intergenic
948409855 2:237750644-237750666 CTGCTGCTCTGCTGTAGAAACGG - Intronic
948723176 2:239914063-239914085 CTGCTGGTCTGGGGAAGTAAAGG - Intronic
948886639 2:240888192-240888214 CTGCTGACCTGGGAGAGAATGGG + Intronic
949015732 2:241709201-241709223 TTTCTTATCTGATGGAGAAATGG - Exonic
1169630130 20:7622232-7622254 CTGCTAATCTGGTGGGGACTTGG - Intergenic
1169849300 20:10032349-10032371 CAGCTAATCTGGTGGGGACATGG + Intronic
1170111903 20:12813831-12813853 CTGGTGATGATGTGGAGAAAAGG + Intergenic
1170763284 20:19270548-19270570 ATCCTCATGTGGTGGAGAAAGGG + Intronic
1171054647 20:21894630-21894652 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1171057653 20:21923083-21923105 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1171064376 20:21999609-21999631 CTAGTGATTTTGTGGAGAAAAGG + Intergenic
1171206382 20:23284498-23284520 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1171342574 20:24442106-24442128 CAGCTGCTCTGGTAGCGAAATGG - Intergenic
1171558953 20:26104267-26104289 CTGCTGATTTGGAGGTGCAATGG - Intergenic
1171887503 20:30668634-30668656 CAGCTGATCAGTTGGGGAAATGG - Intergenic
1173767344 20:45624701-45624723 CTGTTGACCTTGTGGAGGAAGGG - Intronic
1174055633 20:47796284-47796306 CTGCTGTCCTGGTAGAGAAGGGG + Intergenic
1175282407 20:57812935-57812957 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1175815112 20:61879282-61879304 AAGCTGGGCTGGTGGAGAAATGG - Intronic
1176332565 21:5561652-5561674 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1176395192 21:6259299-6259321 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1176441965 21:6729805-6729827 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1176466227 21:7056874-7056896 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1176489788 21:7438652-7438674 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1177680105 21:24356560-24356582 CTGGTGACGTTGTGGAGAAAAGG - Intergenic
1177750855 21:25282436-25282458 CTGGTGAGGTTGTGGAGAAACGG + Intergenic
1177870622 21:26568939-26568961 CTGGTGAGCCTGTGGAGAAAAGG + Intronic
1178386558 21:32156095-32156117 CTGCTGCTCTGGTTAAAAAAGGG - Intergenic
1178698058 21:34810973-34810995 CTGCTGCTCTGCAGGAGGAAGGG - Intronic
1180361322 22:11899974-11899996 CAGCTGATCAGTTGGGGAAATGG + Intergenic
1181496304 22:23289121-23289143 TTCCTCACCTGGTGGAGAAACGG + Intronic
1182591219 22:31381836-31381858 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1183343236 22:37293670-37293692 CTGCAGATCCTGGGGAGAAAGGG + Intronic
1184050729 22:42002104-42002126 CTGCTTGTGTGTTGGAGAAAGGG + Intronic
1185404807 22:50641730-50641752 CTGCTGACCTTGTGGAGAGCAGG + Intergenic
950165785 3:10797575-10797597 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
951271379 3:20628838-20628860 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
951499289 3:23366170-23366192 CTGTTGAGGTTGTGGAGAAAAGG + Intronic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952544223 3:34401187-34401209 CTGGTGAGATTGTGGAGAAAAGG + Intergenic
952998250 3:38906147-38906169 CTGATAATGTGGTGGGGAAAGGG - Intronic
953008773 3:39003663-39003685 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
953184192 3:40622947-40622969 CTGGTGAGGTGGTGGAGAAAAGG - Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
954598188 3:51845569-51845591 CTGCTGGTGGGGTGGAGAAAAGG + Intergenic
955205409 3:56891435-56891457 GTGCTGACAGGGTGGAGAAATGG + Intronic
956689909 3:71866609-71866631 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
957251432 3:77775925-77775947 CTGCAGAAATGGTGCAGAAAGGG + Intergenic
957288487 3:78247065-78247087 CTGCTGATGGGGTAGAGAAGGGG - Intergenic
957446472 3:80318414-80318436 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
957655550 3:83069546-83069568 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
957984647 3:87558192-87558214 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
958268160 3:91464445-91464467 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
958568214 3:95843690-95843712 CTGGTGATGATGTGGAGAAAGGG + Intergenic
958589486 3:96136293-96136315 CTGGTGAGATTGTGGAGAAAAGG - Intergenic
958617979 3:96520589-96520611 CTGCTGAGGAGGTGGAGTAAAGG + Intergenic
958743914 3:98110178-98110200 CTGCTGACAGGGTGGAAAAAGGG - Intergenic
958826057 3:99032636-99032658 CTGTTGATGATGTGGAGAAAAGG + Intergenic
958884684 3:99712573-99712595 CTGCAGATATGGGGCAGAAAAGG - Intronic
958956039 3:100466784-100466806 CTGCTGACAGGGTGGAGAAAAGG - Intergenic
960151666 3:114255355-114255377 CTGCAGATCGGGGGAAGAAATGG - Intergenic
960374437 3:116881141-116881163 CTGTGAATCTTGTGGAGAAAGGG - Intronic
961464966 3:127076185-127076207 CTCCTGATCTGGTGGGGACTTGG - Intergenic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
962484428 3:135828504-135828526 CTGGTGAGGAGGTGGAGAAAAGG + Intergenic
962870224 3:139482560-139482582 CTGCTGAGGATGTGGAGAAAAGG - Intergenic
963993798 3:151683791-151683813 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
964162401 3:153661001-153661023 CTGGTGATGTTGTGAAGAAAAGG - Intergenic
964244122 3:154630963-154630985 CTGATGAGGTTGTGGAGAAAAGG - Intergenic
964498758 3:157324971-157324993 CTGATGAGGTTGTGGAGAAAAGG - Intronic
964529912 3:157656332-157656354 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
965187084 3:165478433-165478455 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
965308936 3:167104130-167104152 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966043901 3:175527103-175527125 CTGCTAATCTGAGGAAGAAAAGG + Intronic
966090062 3:176123020-176123042 CTGCTGATCTGATGGAAGAAGGG - Intergenic
966341729 3:178932654-178932676 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
967531464 3:190553407-190553429 CTCCTGACCTGATGGAGAAAAGG + Intronic
971004054 4:22354266-22354288 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
971302517 4:25453569-25453591 CTCCTGGTCTGGTGGAGCGATGG + Intergenic
971798418 4:31258222-31258244 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
971868847 4:32209253-32209275 CTGCTGAGATTGTGGAGAAAAGG - Intergenic
971936574 4:33157070-33157092 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
972329264 4:38049404-38049426 CTGCTGGCTTGCTGGAGAAATGG - Intronic
972857292 4:43121839-43121861 CTGCTGAGGATGTGGAGAAAAGG + Intergenic
973384132 4:49492422-49492444 CAGCTGATCAGTTGGGGAAATGG - Intergenic
973781431 4:54291635-54291657 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
973838738 4:54839250-54839272 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
975105666 4:70566102-70566124 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
975400248 4:73929244-73929266 CTGGTGATGTTGTGGAGAAAAGG + Intergenic
975992277 4:80268858-80268880 CTGCTCATTTGGGGGATAAAGGG + Intronic
976045022 4:80936146-80936168 ATGATGAGCTTGTGGAGAAATGG + Intronic
977250879 4:94687439-94687461 GTGCTGAAAGGGTGGAGAAAAGG - Intergenic
977367596 4:96090675-96090697 CTGCTGAGGTTGTGGAGAAAGGG + Intergenic
977729787 4:100337560-100337582 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
977801202 4:101234367-101234389 CTGGTGAAGTTGTGGAGAAAAGG - Intronic
978006200 4:103620252-103620274 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
978049119 4:104173396-104173418 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
979281864 4:118877712-118877734 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
979424537 4:120549334-120549356 CAGCCCATCTGGGGGAGAAAAGG - Intergenic
979616810 4:122752278-122752300 CTGCTGAGGATGTGGAGAAAAGG + Intergenic
979988849 4:127350079-127350101 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
980095610 4:128487138-128487160 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
980456071 4:133045444-133045466 CTGCTGATCTGCTGAAGATAAGG + Intergenic
980578806 4:134721402-134721424 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
980722568 4:136717125-136717147 CTGCTGATGGGGTGGAGAAGAGG - Intergenic
981324648 4:143431972-143431994 CTCCTGACCTGGTGGAGAATAGG + Intronic
981456084 4:144954538-144954560 CTGCTAACCCAGTGGAGAAAAGG - Intergenic
982415892 4:155131539-155131561 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
982478088 4:155877457-155877479 CTGCTGACCCAGTGGAGAAAAGG + Intronic
982607625 4:157535170-157535192 CTGATGAGGTTGTGGAGAAAGGG - Intergenic
982677251 4:158390035-158390057 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
983508366 4:168580480-168580502 CTGGTGAAGTTGTGGAGAAAAGG + Intronic
1202767987 4_GL000008v2_random:167747-167769 CAGCTGATCAGTTGGGGAAATGG - Intergenic
985623791 5:972827-972849 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
986123476 5:4865032-4865054 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
986193123 5:5515089-5515111 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
986194926 5:5529415-5529437 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
986213419 5:5695248-5695270 CTGCTGACAGAGTGGAGAAAGGG - Intergenic
986322546 5:6644664-6644686 CTCCTGTTCTGGTTGACAAATGG + Intronic
986513781 5:8539626-8539648 CTTCTAATCTGGTGGGAAAATGG - Intergenic
986686756 5:10281651-10281673 CTGGTTACCTGGTGGAGAAACGG - Intronic
987354471 5:17050734-17050756 CTGCTGAGATTGTGGAGACAAGG + Intergenic
987462143 5:18224351-18224373 CTGGTGATGCTGTGGAGAAAAGG - Intergenic
987484767 5:18511222-18511244 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
987661097 5:20877352-20877374 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
988762547 5:34328341-34328363 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
988801986 5:34704706-34704728 CTGCTTATCGAATGGAGAAATGG - Intronic
988900024 5:35722068-35722090 CTGCTGACAGGGTGGAGAAGAGG + Intronic
989161100 5:38392589-38392611 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
989358579 5:40573203-40573225 CTGCTGATGTGGAGGAGAGAAGG - Intergenic
989403261 5:41032211-41032233 CTGCTAAGGTTGTGGAGAAAAGG - Intronic
989691914 5:44154520-44154542 CTGCTGACAGGGTAGAGAAAAGG - Intergenic
990704851 5:58516238-58516260 GTGGTCATTTGGTGGAGAAAAGG - Intergenic
990840300 5:60072154-60072176 CTGGTGAGCTTGTGGAGAAAAGG - Intronic
990882085 5:60550103-60550125 CTGGTGATTATGTGGAGAAAAGG + Intergenic
990894899 5:60688404-60688426 CTGCTGGTCTGTTGTAGAATAGG - Intronic
992743428 5:79796040-79796062 CTGCAGAACTGGTGGAGACAAGG + Intronic
993631281 5:90288503-90288525 CTGCTGAGACTGTGGAGAAAAGG - Intergenic
993683120 5:90904396-90904418 CTGATGATGATGTGGAGAAAAGG - Intronic
993894805 5:93521720-93521742 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
994284839 5:97952112-97952134 ATGCTGAGGTTGTGGAGAAAAGG - Intergenic
994346307 5:98691253-98691275 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
994433351 5:99696469-99696491 CTGTTGAGGTTGTGGAGAAAAGG - Intergenic
994614303 5:102084134-102084156 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
994971401 5:106744196-106744218 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
995324967 5:110880128-110880150 CAGCTGCTCTGGGAGAGAAAGGG - Intergenic
995448774 5:112277216-112277238 CTGCTGAGATGGTGCACAAAGGG + Intronic
995633124 5:114155521-114155543 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
995830315 5:116348127-116348149 CTGCTGACAGGGTGGAGAAGAGG + Intronic
996142389 5:119928281-119928303 CTGGTGAGGTTGTGGAGAAACGG - Intergenic
996345560 5:122484739-122484761 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
996902559 5:128559422-128559444 CTGCCGAGGTTGTGGAGAAAAGG + Intronic
997022278 5:130015594-130015616 CTGGTGAGATTGTGGAGAAAGGG + Intronic
998692948 5:144607341-144607363 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
998788871 5:145744236-145744258 CTGCTGGTCTGCAGGAGAAAAGG - Intronic
998995889 5:147869117-147869139 CTGCTGACAGGGTTGAGAAAAGG + Intergenic
999567345 5:152879344-152879366 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
999842586 5:155445066-155445088 CTTCTAATCTGGTGGGAAAAGGG - Intergenic
1000547358 5:162619827-162619849 CTGTTGAGGTTGTGGAGAAAAGG - Intergenic
1000721927 5:164718879-164718901 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1001307162 5:170583724-170583746 CTGCTGAGCTGATGGAAAAAGGG + Intronic
1001986144 5:176075638-176075660 CTGCAGCTCTGGGGCAGAAAGGG - Intronic
1002135435 5:177104765-177104787 CTGCTGATCTGGGGAAGGAGTGG + Intergenic
1002230725 5:177762486-177762508 CTGCAGCTCTGGGGCAGAAAGGG + Intronic
1002264611 5:178021262-178021284 CTGCAGCTCTGGGGCAGAAAGGG - Intronic
1002870151 6:1159754-1159776 CTGTTGAGGTTGTGGAGAAAAGG + Intergenic
1003038426 6:2665228-2665250 CTGCTGCTCTAATGGGGAAAGGG - Exonic
1003069767 6:2936399-2936421 TAGCTGATCTGGTGGAGACTTGG + Intergenic
1003311701 6:4974562-4974584 CTGCTGGTCTGGCTGAGACAGGG + Intergenic
1003570166 6:7250705-7250727 CTGGTGAAGTGGCGGAGAAAAGG - Exonic
1004586869 6:17011211-17011233 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1004766339 6:18732040-18732062 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1004766346 6:18732093-18732115 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1004766353 6:18732146-18732168 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1005341860 6:24850764-24850786 TTGGTGTTCTGGTGGAGAAGAGG - Intronic
1005777563 6:29152543-29152565 CTGGTGAGGTGGTGGAGAAAAGG - Intergenic
1007024897 6:38561217-38561239 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1007131923 6:39483181-39483203 CTGCTGATCTTTTGGGGAAAGGG + Intronic
1008203118 6:48617181-48617203 CTGGTGAGGTTGTGGAGAAAGGG - Intergenic
1008779481 6:55085726-55085748 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1008987044 6:57557131-57557153 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1009175001 6:60449698-60449720 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1009631844 6:66210017-66210039 CAGCTGACAAGGTGGAGAAAAGG - Intergenic
1010097996 6:72069160-72069182 CTACTGAGTTGGGGGAGAAATGG + Intronic
1010255093 6:73748518-73748540 CTTCTGATCTAGTGGAAAGAAGG - Intronic
1010335707 6:74680960-74680982 CTGCTGAGGCTGTGGAGAAAAGG + Intergenic
1010647889 6:78414766-78414788 CTGCTGAAGATGTGGAGAAAAGG + Intergenic
1010802056 6:80187834-80187856 CTGGTGAAGTTGTGGAGAAAAGG + Intronic
1010811927 6:80310732-80310754 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1010977568 6:82333039-82333061 CTGCTGAGGATGTGGAGAAAGGG - Intergenic
1011248290 6:85342907-85342929 CTGGTGAGCATGTGGAGAAAAGG - Intergenic
1011309791 6:85969196-85969218 CTGCTGATCTTGGGGAGAGGAGG + Intergenic
1011790558 6:90894066-90894088 CTAATGAGCTGGTGGAGAGAGGG + Intergenic
1011938772 6:92816264-92816286 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1012134171 6:95535332-95535354 CTGCTGGGGTGGAGGAGAAAAGG - Intergenic
1012194776 6:96327781-96327803 CTGGTGAGTTTGTGGAGAAAAGG + Intergenic
1012218997 6:96625326-96625348 ATATTGATCTGGTGGAGGAAAGG - Intergenic
1012645426 6:101673027-101673049 CTGGTGAAGTTGTGGAGAAAAGG - Intronic
1013176394 6:107680990-107681012 CTGCTAACCTTGTGCAGAAATGG - Intergenic
1014335426 6:120127719-120127741 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1015209736 6:130683494-130683516 CTGCTCATTTGATGGGGAAAGGG - Intergenic
1016065109 6:139673977-139673999 CTGCAGAGGAGGTGGAGAAAAGG + Intergenic
1016177992 6:141104425-141104447 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
1016249510 6:142022918-142022940 ATGCTGACCTGGTGTATAAATGG - Intergenic
1017427334 6:154336026-154336048 CTGGTGAGGAGGTGGAGAAAAGG + Intronic
1019756390 7:2773643-2773665 CTGGTGATGAGGTGGAGTAATGG + Intronic
1019915013 7:4127584-4127606 CTGCAGATCTGTAGGAGAAGAGG - Intronic
1020676864 7:11193447-11193469 CTGCTGATGGGGCGGAGAAGAGG - Intergenic
1021189502 7:17603290-17603312 CTGCTCAGCTGCAGGAGAAAGGG - Intergenic
1022749537 7:33209576-33209598 CTGCTGAGAAAGTGGAGAAAAGG - Intronic
1022811849 7:33876693-33876715 CTGATTATTTGGGGGAGAAATGG + Intergenic
1022816903 7:33922689-33922711 TGGATGATCTGGTGGAGAACTGG + Intronic
1022935369 7:35169876-35169898 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1023311772 7:38894843-38894865 CAGCTGATGAGGAGGAGAAAGGG - Intronic
1023347105 7:39281937-39281959 CTCATGATCATGTGGAGAAAGGG - Intronic
1023811572 7:43916145-43916167 TTCCTGGCCTGGTGGAGAAAAGG - Intronic
1023885771 7:44354157-44354179 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1024340712 7:48255943-48255965 CTGGTGAGGTTGTGGAGAAACGG - Intronic
1024378777 7:48670082-48670104 CTGTGGATATGCTGGAGAAATGG + Intergenic
1025856532 7:65285107-65285129 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
1027170232 7:75866674-75866696 CCTCTGGTCTGATGGAGAAATGG - Intronic
1027429633 7:78097171-78097193 CTGGTGAGGTTGTGGAGAAAGGG + Intronic
1028362879 7:89990231-89990253 CTGGTGAAGTGGTGGAGAAAAGG + Intergenic
1028983718 7:96993852-96993874 CTGGGGATGAGGTGGAGAAAGGG - Intergenic
1029831327 7:103262652-103262674 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1029901342 7:104043548-104043570 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1030133927 7:106228007-106228029 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1030370039 7:108688822-108688844 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1030371552 7:108705351-108705373 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
1030454449 7:109755450-109755472 CTGGTGAAGTTGTGGAGAAAGGG - Intergenic
1030733821 7:113020153-113020175 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1030772401 7:113490614-113490636 CTACTAATGTGGGGGAGAAAAGG - Intergenic
1031651699 7:124299331-124299353 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032647581 7:133842287-133842309 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1034755153 7:153609944-153609966 TTGGTAATTTGGTGGAGAAAGGG + Intergenic
1034826805 7:154272730-154272752 CTGCTGAGGAGGTGGAGACATGG + Intronic
1036268361 8:7286611-7286633 CTGCTGAATTGGTGGGTAAACGG + Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037111037 8:15164601-15164623 CTGCTGATGGGGTGGAGAAGAGG - Intronic
1037277064 8:17191939-17191961 CTGGTGAGATGGTGGAGAAAAGG - Intronic
1037372979 8:18200020-18200042 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1037685932 8:21139406-21139428 CTCCTGATCTAGTGTAGAAGAGG + Intergenic
1037813593 8:22100579-22100601 ATGCTGATCTGGAGCAGGAAGGG - Exonic
1038398661 8:27266481-27266503 GGACTGATCTGGAGGAGAAAGGG - Intergenic
1038614653 8:29081279-29081301 CTGCTGCCCTGTTGGGGAAATGG - Intronic
1039309416 8:36299494-36299516 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1040075648 8:43226375-43226397 CTGGTGAGGAGGTGGAGAAAAGG - Intergenic
1040997119 8:53413465-53413487 CTCCTGACCCGGCGGAGAAAAGG + Intergenic
1041055880 8:53985549-53985571 CTGCTGAGCTGGGGGAGGAGAGG - Intronic
1041116518 8:54543120-54543142 CTGTTGAGGTTGTGGAGAAATGG - Intergenic
1041171068 8:55142190-55142212 CTGCTGATCTGCTGGTCAAACGG + Exonic
1041586091 8:59521589-59521611 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1041996458 8:64065890-64065912 CTGGTGAGCATGTGGAGAAAGGG + Intergenic
1042046254 8:64655528-64655550 CTGCTGAAGTTGTGGAGAAAAGG + Intronic
1042197572 8:66245508-66245530 CTGGTGAAATTGTGGAGAAAAGG + Intergenic
1042200017 8:66272445-66272467 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1042278485 8:67029572-67029594 CTGTGATTCTGGTGGAGAAAAGG + Intronic
1042401065 8:68347595-68347617 CTGGTGAGGTTGTGGAGAAAAGG - Intronic
1042786000 8:72547584-72547606 CTGCACATATGGTGGAGAGAAGG + Intronic
1042981700 8:74536742-74536764 CTGGTGAGTTTGTGGAGAAATGG - Intergenic
1043237536 8:77887414-77887436 CTGTTGAGGTTGTGGAGAAAAGG + Intergenic
1043967973 8:86500547-86500569 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1044214071 8:89586495-89586517 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1044221968 8:89679447-89679469 GTGGTGATTTGGAGGAGAAAAGG - Intergenic
1044758918 8:95496160-95496182 CTGCAGTTCCAGTGGAGAAATGG - Intergenic
1045756554 8:105550020-105550042 CTGATTATCAGGTGGAGAGAGGG + Intronic
1046408992 8:113814225-113814247 CTGGTGACATGGTGGAGAAAAGG - Intergenic
1047171141 8:122493458-122493480 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1047264841 8:123296752-123296774 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1048101336 8:131355357-131355379 CTGCTGAGGTTGTGGAGAAAAGG - Intergenic
1048175685 8:132150033-132150055 CTGCTGACAGGGTAGAGAAAAGG - Intronic
1048789312 8:138084978-138085000 TAGCTAATCTGGTGGGGAAATGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1049652726 8:143780960-143780982 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1049757043 8:144315377-144315399 CTGCTGAACTGGTGGTGTGAGGG - Exonic
1050926697 9:11272863-11272885 CTGCTGATGATGTGGAGAAAAGG - Intergenic
1051133787 9:13894606-13894628 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1051221046 9:14848698-14848720 CTGCTGTTCTGATGGAGATGTGG + Exonic
1051318917 9:15878485-15878507 CTGATGAGGTTGTGGAGAAAAGG + Intronic
1051968937 9:22863560-22863582 CTACTCATCTGGTGGAGAAGGGG + Intergenic
1052059753 9:23945885-23945907 CTCCTGACCTAATGGAGAAAAGG + Intergenic
1052429333 9:28346672-28346694 CTGATGAGGTTGTGGAGAAAAGG - Intronic
1052616779 9:30851887-30851909 CTGCTGATGGGGTGGAAAAGAGG - Intergenic
1052678445 9:31657134-31657156 CTGGTGATGTTGTGGAGAAAAGG - Intergenic
1055365261 9:75537192-75537214 CTGGTGAAGTTGTGGAGAAAAGG - Intergenic
1055607191 9:77983101-77983123 CTGCTGTACTGGGGTAGAAAGGG + Intronic
1056112458 9:83409127-83409149 CTGGGAACCTGGTGGAGAAAAGG - Intronic
1056776628 9:89517785-89517807 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1056808571 9:89746724-89746746 CTGGTGTTTTGGTGGAGAAACGG - Intergenic
1057237076 9:93369954-93369976 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1057970100 9:99546711-99546733 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1057980304 9:99654409-99654431 CTGTTGAGGTTGTGGAGAAAAGG + Intergenic
1058252854 9:102723382-102723404 CTGCTGAGAATGTGGAGAAAGGG + Intergenic
1058387012 9:104448273-104448295 CTGCTGCTTTGTTGAAGAAAAGG - Intergenic
1060502226 9:124168093-124168115 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1061158515 9:128879867-128879889 CTGAGGATCTGGTGGAGAACAGG - Intronic
1061616351 9:131782219-131782241 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1203429526 Un_GL000195v1:78680-78702 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1187292075 X:17964303-17964325 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1187605667 X:20880078-20880100 CTGGTGAGGTTGTGGAGAAATGG + Intergenic
1188155288 X:26734303-26734325 CTAGTGATGTTGTGGAGAAAAGG - Intergenic
1188645133 X:32556321-32556343 CTGGTGAGGTTGTGGAGAAAAGG + Intronic
1188710801 X:33395217-33395239 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1188770975 X:34153961-34153983 CTGGTGAAATTGTGGAGAAAAGG - Intergenic
1188775635 X:34215280-34215302 CTGGTGAGGTGGTGGAGAAAAGG + Intergenic
1188828900 X:34872066-34872088 CTGGTGAGGTTGTGGAGAAAGGG + Intergenic
1188831626 X:34905383-34905405 CTGGTGATGATGTGGAGAAAGGG + Intergenic
1188838097 X:34983652-34983674 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
1188942953 X:36262850-36262872 CTGCTGAGGATGTGGAGAAAGGG - Intronic
1188959688 X:36475701-36475723 TTGCTGATGTTGTGGAGAAAAGG + Intergenic
1189152981 X:38726529-38726551 CTGCTGACAGGGTGGAGAAGAGG - Intergenic
1189921349 X:45905930-45905952 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1189935705 X:46066371-46066393 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1190087588 X:47409287-47409309 GTGCTGTTCTGTGGGAGAAAGGG - Intronic
1190108920 X:47577494-47577516 CTGCTGAGCTGGTGGGGAAAAGG + Exonic
1190159232 X:48018070-48018092 CTGCTGAGGTTGTAGAGAAAAGG + Intronic
1190174945 X:48140299-48140321 CTGCTGAGGTTGTAGAGAAAAGG + Intergenic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1190402699 X:50054619-50054641 CTGCTTACCTGGAGTAGAAATGG - Intronic
1190551041 X:51581163-51581185 CTGGTGATGCTGTGGAGAAATGG + Intergenic
1190627071 X:52346466-52346488 CTGGTGGTCTGGGGGAGATACGG + Intergenic
1190643883 X:52506656-52506678 GTGCTGATCTCTTGGTGAAATGG + Intergenic
1190804961 X:53826393-53826415 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1190810174 X:53875510-53875532 CTGGTGAGCTTATGGAGAAAAGG - Intergenic
1190964643 X:55287446-55287468 CTGGTGACTTTGTGGAGAAAAGG - Intronic
1191685911 X:63890672-63890694 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1191738420 X:64411533-64411555 CTGGTGAGTTTGTGGAGAAAAGG - Intergenic
1191747173 X:64502443-64502465 CTGCAGCTCTGTTGGAGTAACGG + Intergenic
1191922822 X:66275557-66275579 GTGGTGAGGTGGTGGAGAAATGG + Intergenic
1192065714 X:67882806-67882828 CTGCTGCTCTGGTTAAGGAAGGG - Intergenic
1192439325 X:71163266-71163288 TTTTTCATCTGGTGGAGAAATGG - Intronic
1192662688 X:73058675-73058697 CTGATGAGGTTGTGGAGAAAAGG + Intergenic
1192901401 X:75501590-75501612 CTGGTGAGATTGTGGAGAAAAGG - Intronic
1193294091 X:79813640-79813662 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193482029 X:82038541-82038563 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1193485921 X:82085556-82085578 CTCCTGACATGGTAGAGAAAAGG + Intergenic
1193486955 X:82097010-82097032 CTGCTGAGGATGTGGAGAAAAGG - Intergenic
1193494381 X:82192519-82192541 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193523758 X:82563365-82563387 CTGCTAAGGTTGTGGAGAAAAGG + Intergenic
1193704422 X:84803829-84803851 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193708255 X:84849550-84849572 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1193739564 X:85202095-85202117 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1193857087 X:86616406-86616428 TTGGTGAGCTTGTGGAGAAAAGG - Intronic
1193957473 X:87879707-87879729 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1194093992 X:89613943-89613965 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1194131536 X:90088283-90088305 CTCCTGAACTGCTGGAGAAAAGG + Intergenic
1194395870 X:93385452-93385474 CTGCTGAGAATGTGGAGAAAAGG - Intergenic
1194575151 X:95603867-95603889 CTGGAGATCATGTGGAGAAAAGG + Intergenic
1194948556 X:100097390-100097412 CTGCTGAGGTTGTAGAGAAAAGG + Intergenic
1194965277 X:100281267-100281289 CTGTTGAGAAGGTGGAGAAAAGG - Intergenic
1195592237 X:106642885-106642907 CTGGTGATGATGTGGAGAAAAGG - Intronic
1195853870 X:109310025-109310047 CTCCTGACACGGTGGAGAAAAGG + Intergenic
1196010597 X:110883460-110883482 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1196530262 X:116778306-116778328 GTGCTGAGGTTGTGGAGAAAAGG + Intergenic
1196565003 X:117194912-117194934 CTGGTGATCATGTGGAGAAAAGG + Intergenic
1196595557 X:117541671-117541693 ATTCTGGTCTGGAGGAGAAATGG - Intergenic
1196630438 X:117932847-117932869 CTGGTGATGATGTGGAGAAAAGG - Intronic
1197052068 X:122071756-122071778 CTGGTGAGCATGTGGAGAAAAGG - Intergenic
1197094836 X:122581497-122581519 CTGGTGGTGTTGTGGAGAAAAGG + Intergenic
1197139341 X:123098614-123098636 CTGGTGAAGTTGTGGAGAAAAGG + Intergenic
1197142824 X:123135446-123135468 CTGGTGAGCTTGTGGAGAACAGG + Intergenic
1197242639 X:124136388-124136410 CTGATGAGGTTGTGGAGAAAAGG - Intronic
1197356394 X:125441042-125441064 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1197391127 X:125866302-125866324 CTGGTGAGGTTGTGGAGAAACGG + Intergenic
1197479625 X:126966275-126966297 CTGCTGACCTGGTGGAGAAAAGG - Intergenic
1197542574 X:127783551-127783573 CTGGTGAGGAGGTGGAGAAAAGG - Intergenic
1197926584 X:131653098-131653120 CTGGTGATGATGTGGAGAAAAGG - Intergenic
1199197726 X:145051194-145051216 CTGCTGAAGATGTGGAGAAAAGG + Intergenic
1199354497 X:146845868-146845890 CTGATGAGGTTGTGGAGAAAGGG + Intergenic
1199371050 X:147048528-147048550 CTGGTGATGACGTGGAGAAAAGG + Intergenic
1199479190 X:148279216-148279238 CTGGTGAGGTTGTGGAGAAAAGG + Intergenic
1199829761 X:151538038-151538060 CTGCTGACAGGGTAGAGAAAAGG + Intergenic
1200076942 X:153555961-153555983 CTGCAGATCTGATGGAGGAAGGG + Intronic
1200446613 Y:3270087-3270109 CTGGTGAGGTTGTGGAGAAAAGG - Intergenic
1201054659 Y:9976471-9976493 CTCCTGTTCTGCTGGAGGAATGG - Intergenic
1202191724 Y:22252980-22253002 CTCCTGTTCTGCTGGAGGAATGG + Intergenic