ID: 1137331467

View in Genome Browser
Species Human (GRCh38)
Location 16:47501817-47501839
Sequence ATCTGATGTTAGAAGCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137331467_1137331468 5 Left 1137331467 16:47501817-47501839 CCAGAATGCTTCTAACATCAGAT 0: 1
1: 0
2: 0
3: 14
4: 202
Right 1137331468 16:47501845-47501867 CTTTAAAGTCCTCATTTTGCAGG 0: 1
1: 0
2: 0
3: 26
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137331467 Original CRISPR ATCTGATGTTAGAAGCATTC TGG (reversed) Intronic
900423115 1:2564266-2564288 ATCTGAAGTTAGAAGCGGTGAGG + Intronic
902647266 1:17808729-17808751 GTCTGGTGTTAGAAGCTTTATGG + Intronic
904382579 1:30121343-30121365 ATCTGAAGGTAGGAGCATTGTGG + Intergenic
907413875 1:54301008-54301030 GTCAGATGTGGGAAGCATTCAGG - Intronic
909339432 1:74515163-74515185 TTCTGTTGTTTGAAGCCTTCAGG + Intronic
909455140 1:75841696-75841718 ATCCTATTTTAGAAACATTCTGG + Intronic
909532147 1:76693268-76693290 ATAGGCTGTTAGAAGCATCCAGG + Intergenic
912106820 1:106288465-106288487 ATTTGCTGTAAGAAGCATTCTGG + Intergenic
913308582 1:117460516-117460538 ATCTGCAGGTAGCAGCATTCTGG + Exonic
914426392 1:147581025-147581047 ATCTGGTTTTAGAAGTATTTTGG + Intronic
917696873 1:177534254-177534276 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
917809928 1:178648521-178648543 ATCTGATAATAGAAGCCTTAAGG - Intergenic
917810104 1:178650261-178650283 ATCTGATAATAGAAGCCTTAAGG - Intergenic
918485929 1:185027990-185028012 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
918758933 1:188376047-188376069 ATGTATTGTTAGAGGCATTCCGG + Intergenic
922108029 1:222529354-222529376 ATCTAATGGTAGAATCACTCTGG - Intronic
922146733 1:222953590-222953612 ATTTGATCTTAGAAGAAGTCTGG + Intronic
1063575008 10:7253495-7253517 ATGTGATGTTAGAAGTGTTGTGG + Intronic
1068044297 10:51866435-51866457 ATCTGATGTTATAATTATGCTGG - Intronic
1068580239 10:58731071-58731093 ATATGTTATTAGAAGCAGTCAGG + Intronic
1070078509 10:73162295-73162317 GTCATATTTTAGAAGCATTCAGG + Intronic
1070224233 10:74483648-74483670 ATATGCTGTTAGAAGCAGACAGG + Intronic
1070262917 10:74874982-74875004 ATCAGATGTAACAACCATTCTGG - Intronic
1070290510 10:75110714-75110736 ATCTGATGTTAGAGAGATTTGGG + Intronic
1070460281 10:76660648-76660670 AATTGGTGTTATAAGCATTCTGG + Intergenic
1071859260 10:89655900-89655922 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1071962686 10:90822453-90822475 ATATGCTGTTAGAAGCAGCCAGG - Intronic
1072660525 10:97360912-97360934 AGCTGATGTCAGAAGCCCTCTGG - Intronic
1072873249 10:99143577-99143599 ATCTTATGTGAGAATCATTAAGG - Intronic
1073979811 10:109142043-109142065 ATATGTTGTTAGAGGCAGTCAGG - Intergenic
1077729357 11:4713094-4713116 ATGTGATGTTTGTACCATTCAGG + Intronic
1079701962 11:23559115-23559137 ATCCGATTTTAGAAGCATTAGGG + Intergenic
1079819414 11:25106151-25106173 ACATGCTGTTAGAAGCATCCAGG + Intergenic
1080707615 11:34712855-34712877 ATATGTTGTTAGAAGCAGCCAGG - Intergenic
1084322463 11:68381289-68381311 TTCTGATGTTAGAAGCCACCTGG + Intronic
1084786221 11:71443281-71443303 ATCTGAACTGAGAAGTATTCTGG + Intronic
1085996596 11:81923510-81923532 ATCAGATGTAAGGAGGATTCTGG - Intergenic
1086799454 11:91153163-91153185 ATATGTTGTTAGAAGCAGCCAGG + Intergenic
1088457170 11:110044784-110044806 ATCTGTTGCTAGAATCATCCCGG - Intergenic
1089451118 11:118597686-118597708 ACCTGTTGTGAGAAACATTCTGG - Exonic
1092853154 12:12648751-12648773 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1093596775 12:20972092-20972114 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1094421875 12:30279791-30279813 AGGTGCTGTTAAAAGCATTCTGG + Intergenic
1095358687 12:41308678-41308700 ATCTGATTTTAAAAGCTTTGGGG + Intronic
1095873073 12:47051492-47051514 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1098319768 12:69231668-69231690 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1098434016 12:70450131-70450153 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1098521209 12:71436929-71436951 TTATGCTGTTAGAAGCACTCAGG + Intronic
1098702996 12:73652764-73652786 ATATGCTGTTAGAAGCAAGCAGG - Intergenic
1101038380 12:100728369-100728391 ATCTGATGTGCTAAGCATTGAGG - Intronic
1102016852 12:109653830-109653852 CTCTGATGTTAGAATCATAAGGG - Intergenic
1104432599 12:128728772-128728794 ATCTTATGTAAAAAGAATTCAGG - Intergenic
1106960393 13:34990844-34990866 ATATGCTGTTAGAAGCAACCAGG + Intronic
1108799509 13:54077444-54077466 ATCTGATGTTAAAACAATTTAGG - Intergenic
1108939169 13:55929191-55929213 ATCTTAGGTAAAAAGCATTCAGG - Intergenic
1109225254 13:59686247-59686269 ATCTGAAGTTAGAATTCTTCCGG - Intronic
1109514367 13:63422765-63422787 ATTTGATTTTAGAAACATTTAGG - Intergenic
1110404698 13:75136827-75136849 AACTCATGTTAGTATCATTCTGG - Intergenic
1110753491 13:79143872-79143894 ATTTGGTGTTATCAGCATTCTGG + Intergenic
1111323765 13:86664439-86664461 TTTTGCTGTTAGAAGCATCCTGG + Intergenic
1111944640 13:94651480-94651502 GTCTGATCTTGGATGCATTCAGG + Intergenic
1112084477 13:96016108-96016130 ATATGTTGTTAGAAGCAGCCAGG - Intronic
1116529383 14:45949094-45949116 CTCTGTTGTTAAAAGAATTCTGG + Intergenic
1117241445 14:53837807-53837829 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1118020679 14:61710644-61710666 ATGTGATGTTTTAAGTATTCTGG + Intronic
1118106431 14:62665449-62665471 GGTTGATGTTAGAAGCATTGAGG - Intergenic
1118426914 14:65675517-65675539 CTCTGCTGTTAGGAGCATTTTGG + Intronic
1120222924 14:81755726-81755748 ATCTGATGTTAGTCACATCCAGG - Intergenic
1120231913 14:81849350-81849372 ATATGATATTAGAAGCAGCCAGG + Intergenic
1120321874 14:82973206-82973228 ACCTGATATTTGAACCATTCAGG + Intergenic
1122614709 14:103009248-103009270 ATTTGATGTTAGAAACAGGCAGG - Intronic
1124021397 15:25928157-25928179 ATCTGATGTTACAAACTTTAGGG + Intergenic
1125737864 15:41940743-41940765 AACTGATCTTCAAAGCATTCTGG + Intronic
1128652489 15:69428731-69428753 ATCTGATTATAGAAGAATTTAGG + Intronic
1132067783 15:98746562-98746584 AGATGATTTTAGAAGCACTCAGG - Intronic
1135472167 16:22740934-22740956 ATCTTATCTTAGAAGCAAGCAGG - Intergenic
1136520709 16:30794024-30794046 GTCTGATGTGTGAAGCATTAGGG - Intergenic
1137331467 16:47501817-47501839 ATCTGATGTTAGAAGCATTCTGG - Intronic
1137339132 16:47582099-47582121 AGCTGATGTTAACAGCAGTCTGG + Intronic
1138640069 16:58378526-58378548 TTCTGATGTTAGAATCATAAGGG - Intronic
1139079271 16:63495290-63495312 AACTGATGTTGGAAGCTGTCTGG - Intergenic
1141022297 16:80508698-80508720 AGCTGATGTGAGAGGAATTCTGG - Intergenic
1141837463 16:86551804-86551826 CTCTGAATTTAGAAGCATTCGGG + Intronic
1143393527 17:6574817-6574839 AGCTGTTGTTCAAAGCATTCAGG + Intergenic
1143456044 17:7068513-7068535 ATGTGCTGTTAGAAGCACCCAGG + Intergenic
1144345736 17:14347422-14347444 CTTTTATGGTAGAAGCATTCTGG - Exonic
1144752532 17:17659301-17659323 ATTTGATGTTGTCAGCATTCTGG - Intergenic
1149391317 17:56194105-56194127 ATTTGATGTTCTCAGCATTCTGG - Intronic
1150603314 17:66669596-66669618 GTCTGCATTTAGAAGCATTCTGG + Intronic
1153103964 18:1506484-1506506 ATCAGAGGTTAGAAACACTCAGG + Intergenic
1156843636 18:41637875-41637897 ATCCGATGTTATTTGCATTCAGG - Intergenic
1157004567 18:43566554-43566576 ATGTTCTGTTTGAAGCATTCGGG - Intergenic
1158604436 18:58882802-58882824 ATCTGATGCTGGAATCTTTCAGG - Intronic
1158613169 18:58961867-58961889 ATCTGTTGCTGGAAGTATTCAGG + Intronic
1158923106 18:62216518-62216540 AACTGATCTTACCAGCATTCAGG - Intronic
1165134227 19:33656342-33656364 ATCAGTTATAAGAAGCATTCTGG + Intronic
1167769340 19:51504642-51504664 ATATGCTGTTAGAAGCAACCAGG - Intergenic
1168362590 19:55754739-55754761 ACCTAATATTAGAAGGATTCTGG + Intergenic
926781769 2:16479371-16479393 ATCTGAGGTTGGTAGCATTATGG - Intergenic
929764773 2:44835120-44835142 ATCTGATGAAAGAATCATCCAGG + Intergenic
934892006 2:98078721-98078743 ATAGGTTGTTAGAAGCATTCAGG + Intergenic
935621064 2:105130020-105130042 GTAAGATGTTAGATGCATTCAGG - Intergenic
938652334 2:133396427-133396449 ATGTGATATGAGAAGCATTTAGG - Intronic
939665673 2:144948439-144948461 ATCAGATCTGATAAGCATTCAGG + Intergenic
940852347 2:158700650-158700672 GTTTAATGTTAGAAGCATTTTGG + Intergenic
943303211 2:186229445-186229467 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
944621328 2:201518461-201518483 ATCAGAGGGTACAAGCATTCAGG + Intronic
945334855 2:208580166-208580188 ATGGGATTTTACAAGCATTCAGG - Intronic
947373648 2:229473866-229473888 GTCTGATGTGAGAAACATCCTGG + Intronic
1169279118 20:4252234-4252256 ATCTCATGTAAGAATCATTTCGG - Intergenic
1170941897 20:20854904-20854926 ATATGTTGTTAGAAGCAGTTAGG + Intergenic
1174443843 20:50577334-50577356 AGCTGATGGCAGAAGGATTCAGG - Intronic
1174885334 20:54327980-54328002 TACTGATGTTAGAAGGATGCTGG + Intergenic
1177055190 21:16293000-16293022 CTCTGAGGTTAGAAGGATTAAGG - Intergenic
1177725758 21:24965269-24965291 ATTTGAAATTAGAAGCATTTTGG + Intergenic
1178704168 21:34859213-34859235 ATCATATGTTAGAACCATTCAGG - Intronic
1178897304 21:36569615-36569637 AACGGATGTTACAAGTATTCAGG + Intronic
1180218830 21:46344921-46344943 TTCTGATGTTGGTAGCATTTGGG + Intronic
1181804157 22:25365062-25365084 TTCTGATGTTAGAAGCCACCTGG - Intronic
1181838356 22:25629774-25629796 ATCTGATGTGAGTAGCATGAAGG + Intronic
950972387 3:17202311-17202333 ATATGCTGTTAGAAGCAGCCAGG - Intronic
951115963 3:18862202-18862224 CTCTGAAGTTGGAAGCAGTCTGG - Intergenic
951568453 3:24037070-24037092 GTATGTTGTTAGAAGCATACAGG + Intergenic
954164107 3:48742290-48742312 TTCTGTTTATAGAAGCATTCTGG - Intergenic
955407585 3:58635284-58635306 ATCTGCTGTTGGAATCATTGTGG + Intronic
955722824 3:61901769-61901791 ATCTGATTTTAGATAAATTCAGG + Intronic
957403062 3:79741998-79742020 ATATGCTGTTAGAAGCAGCCAGG - Intronic
957843509 3:85700545-85700567 ATAAGGTATTAGAAGCATTCAGG + Intronic
958876321 3:99621752-99621774 ACCTGCTGTAAGAAGCATTGGGG - Intergenic
959149398 3:102590782-102590804 ATATGCTGTTAGAAGCAACCAGG - Intergenic
959879622 3:111428680-111428702 ATATGATGTTAGAAGCAGCCAGG - Intronic
964545493 3:157829152-157829174 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
965394965 3:168152313-168152335 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
965870175 3:173255110-173255132 GTAGGATGTTAGAAGCATCCAGG + Intergenic
970962066 4:21883941-21883963 TTCTGTTGTTAGAAATATTCGGG + Intronic
972422068 4:38897152-38897174 ATCACAAGTTAGCAGCATTCAGG - Intronic
974457335 4:62145220-62145242 ATAGGTTGTTAGAAGCATCCAGG - Intergenic
975231386 4:71937928-71937950 TTCTGATCCTAGAAGCATTCAGG + Intergenic
976266335 4:83188961-83188983 ATCAGAGGTAAGAAGAATTCAGG - Intergenic
976294964 4:83461164-83461186 ATCTGATGTTACAAACTTTAGGG - Exonic
977937616 4:102825793-102825815 AACTGATGTAAAAGGCATTCTGG - Intronic
978990746 4:115078871-115078893 ATAGGTTGTTAGAAGCATCCAGG - Intronic
983098640 4:163596919-163596941 AAATGATGTAAGAATCATTCTGG - Intronic
983886726 4:172988395-172988417 ATATGCTGTTAGAAGCAGCCAGG - Intronic
987226576 5:15847910-15847932 AGGTGTTGTTAGAAGAATTCAGG - Intronic
987615606 5:20270067-20270089 ATTTTATTTTTGAAGCATTCAGG - Intronic
987918627 5:24249206-24249228 ATATGCTGTTAGGAGCAGTCAGG + Intergenic
990262279 5:54036179-54036201 ATCAGATATAAGAAACATTCTGG + Intronic
991186505 5:63815071-63815093 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
996032592 5:118722423-118722445 AACTAATGGTAGAAGCACTCTGG - Intergenic
998045183 5:138981269-138981291 ATTTCTTGTGAGAAGCATTCTGG + Intronic
1000364744 5:160480399-160480421 ATCTGCAGATAGAAGGATTCTGG - Intergenic
1001927691 5:175650427-175650449 ATAGGCTGTTAGAAGCAGTCAGG + Intergenic
1002828532 6:796287-796309 ATCTGCTGTTAGAAGCAAGAAGG - Intergenic
1003351291 6:5319860-5319882 ATAGGTTGTTAGAAGCAGTCTGG - Intronic
1004076930 6:12352095-12352117 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1006364123 6:33604991-33605013 ATAGGTTGTTAGAAGCAGTCAGG + Intergenic
1006818404 6:36870121-36870143 ATCTATGGTCAGAAGCATTCAGG - Intronic
1008104735 6:47429236-47429258 ATAGGTTGTTAGAAGCATCCAGG + Intergenic
1009467292 6:63987407-63987429 AACTGATTTTAGCATCATTCTGG - Intronic
1009804210 6:68581270-68581292 GTAAGAAGTTAGAAGCATTCTGG - Intergenic
1009819198 6:68777876-68777898 AGCTGATGTTTGAAACATGCTGG + Intronic
1010348403 6:74840817-74840839 ATAGGTTGTTAGAAGCAGTCAGG - Intergenic
1010360379 6:74986697-74986719 ATAGGATGTTAGAAGCAGCCAGG - Intergenic
1010527687 6:76923969-76923991 ATAGGTTGTTAGAAGCATCCAGG - Intergenic
1012039449 6:94185559-94185581 ATAGGTTGTTAGAAGCAGTCAGG + Intergenic
1012255343 6:97025286-97025308 ATCTGATGTTGACTGCATTCTGG + Intronic
1015803481 6:137084817-137084839 ATGTGAAGTTAGAATCATTTTGG + Intergenic
1015866734 6:137734592-137734614 ATCTGAGGTAACAAGTATTCTGG + Intergenic
1017938165 6:159025440-159025462 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1019107115 6:169677426-169677448 GTATGTTGTTAGAAGCATCCAGG - Intronic
1022076199 7:26973628-26973650 ACCTGCTTTTAGAAGCAGTCTGG + Intronic
1022420730 7:30220742-30220764 ATTTGGTGTTATCAGCATTCTGG - Intergenic
1023040818 7:36171851-36171873 CTCTGATGTTAGCAGCCATCAGG - Intronic
1024729113 7:52235032-52235054 ATATGCTGTTAGAAGCAGTCGGG - Intergenic
1030347259 7:108448399-108448421 TTCTGATGTTAGTAGCATGATGG - Intronic
1030357396 7:108557408-108557430 ATATGCTGTTAGAAGCAGCCAGG + Intronic
1032742857 7:134756648-134756670 ATCTGATCTAAGAATCATGCAGG - Intronic
1033374777 7:140747908-140747930 ATCTGATGTTTTAAGCCTGCAGG - Intronic
1034432302 7:151047150-151047172 ATCTGGTGTCAGAGGCATTTTGG - Intronic
1035180202 7:157083956-157083978 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1036458802 8:8933729-8933751 ATCTGATGTTACAACCTTTAGGG + Intergenic
1037362367 8:18087068-18087090 ATCTGATGTTATAAACTTTAGGG - Intergenic
1038201541 8:25417619-25417641 TGCTGATGTTAGAGGCTTTCAGG - Intronic
1039230680 8:35444069-35444091 ATCTAATGTTAAAAGTATTTGGG + Intronic
1039987231 8:42457846-42457868 ATATAATGTTAGAATCATTTAGG + Intronic
1042501720 8:69515729-69515751 ATATGCTTTTAGAAGCAGTCAGG + Intronic
1043199035 8:77339892-77339914 ATATGCTGTTAGAAGCAGCCAGG - Intergenic
1044114501 8:88318199-88318221 ATCTGATTTTCAAAGTATTCAGG - Intronic
1044148001 8:88741613-88741635 ATCAGATGTTAGAAGCATCTGGG + Intergenic
1047688187 8:127322663-127322685 ATAAGCTGTTAGAAGCAGTCGGG - Intergenic
1047816069 8:128464409-128464431 ACTTGATGTTATAAGCATTATGG - Intergenic
1048153671 8:131919906-131919928 ATCTGATACTGGAAGCTTTCAGG - Intronic
1051101913 9:13531590-13531612 ATGTGTTGTTTGAAGAATTCCGG + Intergenic
1051582803 9:18695489-18695511 ATATGCTGTTAGAAGCATCCAGG + Intronic
1056975082 9:91245642-91245664 ATCTGCTGATAGAAGCAAACGGG + Intronic
1058052567 9:100421684-100421706 CTCTGATGGTAGAGGCAGTCTGG - Intergenic
1059096296 9:111418647-111418669 TTCTTAGGTTAGAACCATTCAGG - Intronic
1061891901 9:133626204-133626226 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1186903098 X:14079289-14079311 TTCTGATGTTTTAAGCAATCTGG + Intergenic
1186935675 X:14448423-14448445 ATCTGTTGTAAGAAGCCTTCAGG + Intergenic
1186950261 X:14616585-14616607 ATCTCTAGTTAGAAGCATTCTGG - Intronic
1188387089 X:29574772-29574794 ATATGCTGTTAGAAGCAGCCAGG + Intronic
1190804950 X:53826276-53826298 ATCTGATGTTACAAACTTTAGGG - Intergenic
1191211134 X:57885928-57885950 ATATGCTGTTAGAAGCAGCCAGG + Intergenic
1191873268 X:65768642-65768664 ATATGGTGTTAGAAGCAGTCTGG - Intergenic
1192066554 X:67891198-67891220 ATATAGTGTTAGAAGCACTCAGG - Intergenic
1192071151 X:67942303-67942325 ATATGCTGTTAGAAGCAACCAGG + Intergenic
1193827226 X:86241443-86241465 ATATGCTGTTAGAAGCAGCCAGG - Intronic
1193865771 X:86728296-86728318 ATATGTTGTTAGAAGCAGCCAGG - Intronic
1193939144 X:87658476-87658498 ATCTGATGTTGGGAGCAGTGGGG - Intronic
1194636971 X:96357760-96357782 ATCTGATATTAGAATCATGCTGG - Intergenic
1194821886 X:98518804-98518826 ATCTAATGTTACAAACATTATGG + Intergenic
1195043786 X:101037856-101037878 AGCTGATGTTATTAGCATTAAGG + Intronic
1197472615 X:126882098-126882120 ATAGGATGTTAGAAGCAGCCAGG - Intergenic
1197821609 X:130546596-130546618 AACTGAGGTTAAAAGCCTTCAGG - Intergenic