ID: 1137332705

View in Genome Browser
Species Human (GRCh38)
Location 16:47514809-47514831
Sequence TAATATCACTTTAACAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 534}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137332705 Original CRISPR TAATATCACTTTAACAAAAA AGG (reversed) Intronic
900562616 1:3314912-3314934 TACCATCACTTTATCATAAATGG - Intronic
901249719 1:7767893-7767915 TAACATTACTTAAAAAAAAAAGG + Exonic
901345191 1:8533909-8533931 TAAGATAACTTTAATAAAACAGG - Intronic
901584920 1:10281722-10281744 TAATATGTCTTAAATAAAAAAGG - Intronic
904216124 1:28921229-28921251 TAAAATCATTTTAACACAATGGG + Intronic
904878934 1:33679690-33679712 TAAAATAAATTGAACAAAAATGG - Intronic
905425165 1:37877868-37877890 TATGATCTCTTTTACAAAAAAGG + Intronic
906182279 1:43832375-43832397 TTCTATCACTTTAAGAAAAAAGG - Intronic
906673668 1:47677807-47677829 TAATACCACTTTCCCTAAAATGG - Intergenic
907655582 1:56339011-56339033 TATTACCAATTTAATAAAAAAGG - Intergenic
908231861 1:62113116-62113138 TAATGTCTATTTAACAGAAAAGG + Intronic
908572245 1:65421691-65421713 TAATATCAGTTTAGTAAACATGG + Intronic
908984847 1:70005382-70005404 TAATTTCACTTTAACATCATTGG - Intronic
909685855 1:78347612-78347634 TACTATCATTTTTAAAAAAATGG - Intronic
909854301 1:80508459-80508481 TAATATCATTTTAGAAAAAATGG + Intergenic
910220279 1:84883089-84883111 TTATCTCCCTTTTACAAAAAAGG - Intronic
910786568 1:91004874-91004896 AAATATCTATTTAACACAAAAGG + Intronic
910848355 1:91625993-91626015 TGATATCTCTTCAACAAAAAGGG + Intergenic
910894117 1:92049794-92049816 TTATACCACTTTAAATAAAAAGG - Intronic
911534234 1:99080449-99080471 TAATATCAGTATCACAAAATTGG - Intergenic
911559010 1:99381316-99381338 ATCTAACACTTTAACAAAAATGG - Intergenic
911763020 1:101638520-101638542 TAATATCATTTTTACATTAAGGG - Intergenic
912582912 1:110736225-110736247 AAATATAATTTTAACAAACATGG + Intergenic
912715043 1:111977452-111977474 AAAAATCACTTTAATGAAAACGG - Intronic
914255504 1:145958953-145958975 TAATCTCACCTAAGCAAAAATGG - Intergenic
915761831 1:158321607-158321629 GAATATCACTTAACCACAAAAGG - Intergenic
916669585 1:167002204-167002226 TAATCTGTCTTTAACATAAATGG - Intronic
916899888 1:169210144-169210166 AAATCTCAATCTAACAAAAATGG + Intronic
917336755 1:173931416-173931438 AAATAGCATTTTAACAAAATGGG + Exonic
918103232 1:181394693-181394715 AAATATCACCTTAACAATGATGG - Intergenic
919392467 1:197004479-197004501 GAATTTCACTTTAACATGAAAGG + Intronic
919439277 1:197608936-197608958 TATTAATACATTAACAAAAAAGG + Intronic
921001530 1:211049237-211049259 TAAAAGTACTTTAACAACAAGGG + Intronic
921391522 1:214619617-214619639 AAATAACACGTGAACAAAAATGG - Intronic
921521943 1:216166900-216166922 CCATATCATTTTCACAAAAAAGG - Intronic
921596042 1:217054842-217054864 TAATATCACTGAAACAACACAGG + Intronic
922328791 1:224555663-224555685 GAATATTAATTTAACAAACAAGG + Intronic
922407579 1:225331967-225331989 TACTTTCACTTAAAAAAAAAGGG - Intronic
923536373 1:234855248-234855270 AAAAATCACTTTTACAAAATGGG - Intergenic
923846604 1:237740239-237740261 TAAGATCACACAAACAAAAAAGG - Intronic
923923099 1:238591477-238591499 TAATATCAGATGAATAAAAACGG + Intergenic
924010595 1:239661004-239661026 TTATATCACTTTTACAAACAGGG + Intronic
924092461 1:240515628-240515650 TACTAGCACTTAAAGAAAAAGGG + Intronic
924771232 1:247081221-247081243 TAACATGCCTTTAACAAAAAAGG - Intergenic
1063875291 10:10470274-10470296 TAAACTCATTTTAAAAAAAAGGG - Intergenic
1064836814 10:19541758-19541780 TATTAACACTTTAGCAAAGATGG + Intronic
1065307036 10:24379067-24379089 TAATATTACTTTAAGCAACATGG - Intronic
1065516200 10:26526738-26526760 TAATATCAATTTATCATAAAAGG + Intronic
1065921342 10:30395643-30395665 TAATATCAATCTAGCTAAAAAGG - Intergenic
1067353650 10:45502990-45503012 TAAGATAACTGTAACAGAAAGGG + Intronic
1067747200 10:48944762-48944784 TAGTATGACCTAAACAAAAAAGG - Intronic
1068304672 10:55192031-55192053 TAATATCACACTAAAATAAAGGG + Intronic
1068731691 10:60365197-60365219 TGATATCTCTGTAACAGAAAAGG - Intronic
1070336562 10:75460976-75460998 AAAGATCATTATAACAAAAAAGG + Intronic
1071408662 10:85364040-85364062 TAATATATATTTAAAAAAAAAGG - Intergenic
1071662675 10:87520347-87520369 GAATATCACTTTATAAGAAATGG + Intronic
1071758925 10:88578307-88578329 TAATATTACATGAACAGAAAGGG + Intronic
1071760775 10:88603631-88603653 TAATTTTACTTTAAAAATAAAGG - Intronic
1071913638 10:90265281-90265303 AAAAATCACTATCACAAAAATGG + Intergenic
1072491564 10:95910883-95910905 AAAAATCACTTTCACAAAAAGGG - Intronic
1072503434 10:96042148-96042170 TAAGAACACTTTCAGAAAAATGG - Intergenic
1073245847 10:102089402-102089424 AAATCTCACTTTAACCACAATGG + Intergenic
1074222265 10:111449579-111449601 TAATATCAATCTAACTGAAATGG - Intergenic
1074489667 10:113927868-113927890 TGATAACACTTGAATAAAAAGGG - Intergenic
1074840891 10:117349869-117349891 TAATATAACTATATCAAAAAAGG + Intronic
1075625151 10:123958743-123958765 TAATTTCACTGTAACAATTATGG + Intergenic
1076286467 10:129302496-129302518 AAATATCATTTTCCCAAAAAAGG + Intergenic
1076306423 10:129468357-129468379 TAATATCACGTTAACTCAGAGGG + Intronic
1076331024 10:129667081-129667103 TATTATCTTTATAACAAAAATGG - Intronic
1076456022 10:130597104-130597126 TCATCTCAGTTTAACAGAAAAGG - Intergenic
1079191896 11:18285200-18285222 TACTATCACTTAAAACAAAAAGG + Intronic
1079505382 11:21147140-21147162 TACTATCACTCTCACTAAAAGGG - Intronic
1079600666 11:22309402-22309424 TTATATCACTGTAATTAAAAGGG + Intergenic
1079937460 11:26635338-26635360 TAATAATAATTTAAAAAAAAAGG - Intronic
1079976411 11:27097262-27097284 TAATATCACCTTTCCTAAAAGGG - Intronic
1080724915 11:34887557-34887579 TAATAACACTTTAGTAAAACTGG + Intronic
1081346230 11:41990033-41990055 CAAAATCACTTGAACAAATAGGG + Intergenic
1082636511 11:55600886-55600908 TGGTATCACTTTAAAATAAAAGG - Intergenic
1082930742 11:58602361-58602383 TAATACCACAATCACAAAAATGG - Intronic
1083505504 11:63153561-63153583 TAATATCACTTTCAGCAACATGG - Intronic
1085491683 11:76925034-76925056 TAATATCCCTTTTACAAGAAGGG + Intronic
1086013979 11:82142046-82142068 TTCTATCATTTTAACAAAAATGG - Intergenic
1086267062 11:85012780-85012802 TAAAATCACTTTAGCAAAAATGG - Intronic
1086931943 11:92703371-92703393 TAATTTAACTTCAAGAAAAATGG + Intronic
1087004482 11:93455680-93455702 TTAAATCACTTAAAAAAAAAAGG + Intergenic
1087480080 11:98688672-98688694 AAAAATAAATTTAACAAAAAAGG - Intergenic
1087689689 11:101306037-101306059 TAGTATTACTTTACCAAAACAGG + Intergenic
1087802218 11:102516708-102516730 TTTCATCCCTTTAACAAAAATGG - Intergenic
1088355130 11:108934979-108935001 TACCATCACTGCAACAAAAAAGG - Intronic
1088465520 11:110132924-110132946 TAATATAACTTTTAAAAGAACGG - Intronic
1088573394 11:111245268-111245290 TAATGTCACTTTAATACAATTGG - Intergenic
1088949169 11:114548017-114548039 AAATACCACATTAAAAAAAAGGG + Intronic
1092851853 12:12636381-12636403 TAAAGTCACTTAAACACAAATGG - Intronic
1092909061 12:13129291-13129313 TATTATTACTTTCACATAAATGG + Intronic
1093623924 12:21324311-21324333 TAATTTCTCTTTAATAGAAAAGG - Intronic
1093726758 12:22521852-22521874 AAATTTCACTTTAAAAAAGATGG + Intronic
1093824988 12:23673669-23673691 TAATATAAAATTAATAAAAATGG + Intronic
1093853988 12:24076194-24076216 TGATATCCCTTTAATTAAAATGG + Intergenic
1094262497 12:28517175-28517197 TTAAATTACTTAAACAAAAAAGG + Intronic
1094594357 12:31851052-31851074 TAATTTGTCTTTAATAAAAATGG + Intergenic
1094730630 12:33170390-33170412 AAATATTAATTTAAAAAAAATGG + Intergenic
1094757731 12:33491913-33491935 AAAAATCACTTTCACAAAAAAGG + Intergenic
1095904127 12:47360069-47360091 CAACAGCACTTTAAAAAAAAAGG - Intergenic
1097716953 12:62977106-62977128 TAATATTAATTAAACCAAAATGG - Intergenic
1097739592 12:63225289-63225311 TAATATCAATTAACCAAAATAGG + Intergenic
1097898930 12:64854178-64854200 AAAAATCACCTTCACAAAAAAGG - Intronic
1098403278 12:70096572-70096594 GAATATTACTCTAATAAAAAAGG - Intergenic
1098716930 12:73840818-73840840 TAATAACATTTAAACAGAAAAGG - Intergenic
1098869239 12:75798309-75798331 GAATATCACTATAAAATAAACGG - Intergenic
1099074879 12:78094238-78094260 TGAAAGCACTGTAACAAAAATGG + Intronic
1099206571 12:79735424-79735446 TAAAATGACTTTTATAAAAAAGG + Intergenic
1099369763 12:81814511-81814533 TAATATCCCTTTGACAACACTGG + Intergenic
1099742102 12:86651700-86651722 TAATATCACTTTTTTAAAAAAGG + Intronic
1099803410 12:87486706-87486728 TATTATCAATTTATCAAAATTGG - Intergenic
1100866206 12:98859772-98859794 TAAGATCACTGTAAGCAAAATGG + Intronic
1100923705 12:99519755-99519777 GAAAATCACTTTCACTAAAAGGG - Intronic
1101548728 12:105741685-105741707 TAATCTCACTTTTACAAATGAGG - Intergenic
1102972094 12:117176959-117176981 CAAAATCATTTTAAAAAAAATGG + Intronic
1103102077 12:118186381-118186403 TAATATCTCTATCACAGAAACGG + Intronic
1104678977 12:130736001-130736023 GAAAATCACTGAAACAAAAATGG - Intergenic
1104794330 12:131506627-131506649 TGATCTCACCTTAACCAAAATGG - Intergenic
1105743389 13:23352631-23352653 TAATACAACATTAAAAAAAAAGG + Intronic
1106748712 13:32734115-32734137 GAAAATCACTTGAACAAGAAAGG - Intronic
1106901716 13:34360638-34360660 TAGTATGACTTAAACATAAAAGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107048662 13:36023637-36023659 TAATACCACATTGATAAAAAAGG + Intronic
1107135548 13:36940375-36940397 TAAACTCACTTGAATAAAAAAGG - Intergenic
1107476496 13:40741244-40741266 TAATATAAGTTTAATATAAAAGG - Intronic
1108444163 13:50490125-50490147 TAATATGATTATTACAAAAATGG - Intronic
1108820530 13:54344233-54344255 AAATATTGCTTTAACCAAAATGG - Intergenic
1108945815 13:56021532-56021554 TAATATCAGTTTTGGAAAAAAGG - Intergenic
1109031647 13:57198104-57198126 GAAAATCACTTTGACAAAAAGGG - Intergenic
1109054650 13:57532236-57532258 TAAAATCAATTTAACTGAAAAGG - Intergenic
1109718648 13:66248912-66248934 TAATTTCTCTTTAACAAAACTGG - Intergenic
1110296228 13:73868931-73868953 AAATATGACTTTAAAAAATATGG - Intronic
1110709567 13:78635274-78635296 TATTATCACTCTAAAAAATACGG - Intronic
1110868689 13:80424963-80424985 TAATCTAACTTAAAAAAAAATGG - Intergenic
1111240124 13:85462713-85462735 TGATATCAATTTAAATAAAAAGG + Intergenic
1111241483 13:85481226-85481248 TAATCCCACTTTTGCAAAAAAGG - Intergenic
1111372820 13:87338556-87338578 TAATGTCATTTTTACAAAATGGG + Intergenic
1111608600 13:90574962-90574984 TAATTTCATTAGAACAAAAATGG - Intergenic
1111686357 13:91505821-91505843 TAATATCTCCTTTATAAAAAAGG - Intronic
1111962937 13:94831363-94831385 TAAAATCTCTTTAATAAGAATGG - Intergenic
1112120933 13:96410756-96410778 GAATATCACTTTGTCAAAATTGG + Intronic
1112270200 13:97961597-97961619 TAAAATGGCTTTAATAAAAAAGG - Intronic
1112931127 13:104739399-104739421 TAATATCATTTAAATAAACATGG + Intergenic
1113066688 13:106379901-106379923 TATCATCACTTGAAAAAAAATGG + Intergenic
1113429767 13:110240039-110240061 TTATATCATTTTAACAAAAATGG - Intronic
1114902887 14:27087123-27087145 TACAATCAGTTTAACAAACATGG + Intergenic
1114985501 14:28222751-28222773 CAATATGATTTTAAGAAAAATGG - Intergenic
1115573749 14:34691237-34691259 AAATATCACTTTGGCATAAAAGG - Intergenic
1115878326 14:37886736-37886758 TAATATCCCTCTATCAAAAATGG - Intronic
1115894358 14:38068533-38068555 TACTATCACTTATATAAAAATGG + Intergenic
1116196178 14:41728806-41728828 TTTTATCACTTTGACAAAAATGG + Intronic
1116612746 14:47098382-47098404 TAACATCACTTTAAATAATATGG + Intronic
1116719358 14:48474709-48474731 TAATAGCAGTTTAAAAATAATGG - Intergenic
1118624037 14:67640720-67640742 TAATCTGACTGTATCAAAAAGGG - Intronic
1119009071 14:70964799-70964821 TAATAACTTTTTAATAAAAATGG + Intronic
1120142405 14:80943510-80943532 TAATATCACTTTGAAAAATAAGG - Intronic
1120369850 14:83619460-83619482 TTATATCATTTTAAGAAAAAGGG + Intergenic
1120421908 14:84298228-84298250 TAATATCCTTTTGACAATAAAGG + Intergenic
1120640691 14:87008322-87008344 TAAAATCAATTTAACATAAAAGG + Intergenic
1120786678 14:88544430-88544452 TAACATAACATCAACAAAAATGG + Intronic
1124009649 15:25827689-25827711 AAATATCTATTTGACAAAAAAGG + Intronic
1124026404 15:25970677-25970699 TAATTTAAATTTAATAAAAAAGG + Intergenic
1126486256 15:49184682-49184704 TAATATCAGTTTAAAACAATGGG - Intronic
1129735769 15:77961636-77961658 TAATATCAATCTAGCTAAAAAGG - Intergenic
1129836108 15:78707482-78707504 TAATATCAATCTAGCTAAAAAGG + Intronic
1131340751 15:91598514-91598536 TAATTCCACTTTAGAAAAAAAGG + Intergenic
1131627926 15:94143558-94143580 TAATATCACTTGAAGTAAGATGG - Intergenic
1131794616 15:96002584-96002606 TAATAACAGTTTTACACAAAGGG + Intergenic
1132200156 15:99947266-99947288 AAATATCTTTTTAACAGAAAAGG - Intergenic
1132319696 15:100917233-100917255 CACCACCACTTTAACAAAAAAGG + Intergenic
1133628715 16:7597584-7597606 TAAGATCATTTTCACAACAAAGG + Intronic
1134670447 16:16050960-16050982 TAGTAGCACTTTTACAAAAGTGG - Intronic
1135703794 16:24656639-24656661 TAACACCAGGTTAACAAAAAGGG + Intergenic
1137332705 16:47514809-47514831 TAATATCACTTTAACAAAAAAGG - Intronic
1137443496 16:48516329-48516351 TAACACCCCTTTAACAGAAATGG + Intergenic
1137498275 16:48988384-48988406 TAGAATAACTTTAAAAAAAAAGG - Intergenic
1137920694 16:52485648-52485670 TAAAATAAAATTAACAAAAAAGG + Intronic
1138045147 16:53714680-53714702 TAATGTAACTAAAACAAAAATGG - Intronic
1138135659 16:54519365-54519387 AAATATCATGTTAACAAAAATGG - Intergenic
1139015656 16:62685671-62685693 TAATATCACAAAAAAAAAAATGG - Intergenic
1139059817 16:63236234-63236256 TAACATCATATTAAGAAAAAAGG - Intergenic
1139196383 16:64923359-64923381 AAAAACCAATTTAACAAAAAGGG - Intergenic
1141081180 16:81054504-81054526 ATATATCACGTTACCAAAAAAGG - Intronic
1141089440 16:81120169-81120191 TAAGTTCACTTTTACAACAAAGG + Intergenic
1141330252 16:83104537-83104559 TAAAATGTCTTTAGCAAAAAAGG + Intronic
1143687784 17:8532891-8532913 TTATATCCCTTAACCAAAAATGG - Intronic
1144271277 17:13618984-13619006 TAATATCACATTACCAAGTATGG - Intergenic
1146430743 17:32791696-32791718 TAATTTCAAATTTACAAAAAAGG - Intronic
1147416957 17:40298993-40299015 TAATATTACATTACCACAAAGGG - Intronic
1149964956 17:61152890-61152912 AAATAACAGTTTAACAATAAGGG - Intronic
1152075855 17:78159128-78159150 TAATATGATTTAAAAAAAAAAGG + Intronic
1152243408 17:79172259-79172281 AGATATCACTATCACAAAAATGG + Intronic
1153815906 18:8789979-8790001 TAATATTGCATTAGCAAAAATGG + Intronic
1154968766 18:21386063-21386085 TAATATCATTTTAAAGATAAAGG + Intronic
1155131116 18:22935356-22935378 AAATATCCCTTTAACAGATAAGG + Intronic
1155681077 18:28487225-28487247 TAAAATAACTATTACAAAAACGG + Intergenic
1155758840 18:29538423-29538445 AAAGATTACTTTAACAATAAGGG - Intergenic
1155820340 18:30367772-30367794 TAATATTGCTTTATTAAAAATGG - Intergenic
1155998074 18:32353145-32353167 AAATATTAATGTAACAAAAATGG - Intronic
1156449072 18:37256391-37256413 AAATAGCACTTTAAGAACAAAGG + Intronic
1156620842 18:38849737-38849759 GAATATTAGTTTAACCAAAAAGG - Intergenic
1156690861 18:39705109-39705131 TAATTTTACTTTAAGAAAAGAGG - Intergenic
1156696347 18:39772887-39772909 TACTATTACTTTACCAACAAGGG - Intergenic
1156773252 18:40756126-40756148 TAATGTCACATTTACAAACATGG - Intergenic
1156997952 18:43491094-43491116 TAATACAAATCTAACAAAAAAGG + Intergenic
1158156995 18:54437277-54437299 TATATTCAATTTAACAAAAAGGG + Intergenic
1158368956 18:56775246-56775268 TAATTTCACTTTTTCAAAAATGG - Intronic
1158382385 18:56947128-56947150 TTTTATCACTGTAACAAATATGG + Intronic
1158752929 18:60286485-60286507 TAATCTCCTTTTAACAATAAAGG + Intergenic
1158801430 18:60914768-60914790 TCAGATAACTTTAATAAAAAAGG - Intergenic
1159085193 18:63782211-63782233 TCAAATAACTCTAACAAAAAGGG - Intronic
1159285808 18:66348849-66348871 TAACATCAATTAAACAATAAAGG - Intergenic
1159290905 18:66418278-66418300 CAATATGATTTTAGCAAAAATGG - Intergenic
1160311566 18:77796672-77796694 GAACATCACTGAAACAAAAAGGG - Intergenic
1162221702 19:9182980-9183002 TAATATCAATTTGACATACACGG + Intergenic
1162813047 19:13176247-13176269 TAAGAATACTTTAAAAAAAATGG + Intergenic
1163894171 19:20042694-20042716 AAATATCAATGAAACAAAAATGG - Intergenic
1164278638 19:23748091-23748113 TAATATCATATCAAAAAAAATGG - Intronic
1164414172 19:28032422-28032444 CAATGTCACTTTAACAATATTGG + Intergenic
1164696783 19:30250906-30250928 TAATACCACTTTTTAAAAAAAGG - Intronic
1165039393 19:33058383-33058405 TAATGTCATTTTAAAGAAAAGGG + Intronic
1166627159 19:44368558-44368580 TAAAATTACAATAACAAAAAGGG - Intronic
926662274 2:15480810-15480832 TAAGATCACCTCAATAAAAAAGG - Intronic
926979750 2:18555880-18555902 TAATTACATTTTAATAAAAATGG + Intronic
928246744 2:29636487-29636509 TTATAACACTTTAAAAAAATAGG + Intronic
928286904 2:29998553-29998575 CAATATCTATTTAACAAAGAAGG + Intergenic
928603499 2:32923678-32923700 TATTATCACATTCACACAAATGG - Intergenic
928828782 2:35453597-35453619 TAACATGACTTTAACAATTAGGG + Intergenic
929670361 2:43872372-43872394 TAAATTCACTTTAATAGAAAGGG - Intronic
930858999 2:56050446-56050468 CACTATCACTTTAAAACAAATGG - Intergenic
930987499 2:57608393-57608415 GAATAGAACTTTACCAAAAATGG + Intergenic
931193929 2:60032243-60032265 GAAAATCACTTTCACAATAAAGG + Intergenic
931401900 2:61939058-61939080 TAATTTCTCTTTAATAGAAAAGG - Intronic
932843324 2:75106161-75106183 AAATATAACTTTATTAAAAATGG + Intronic
933025906 2:77258656-77258678 TAATTTAACCATAACAAAAAGGG - Intronic
933077404 2:77946528-77946550 TAATAGTACTTTTCCAAAAATGG - Intergenic
933386119 2:81612624-81612646 TAATTTCACTTGACTAAAAAAGG - Intergenic
933589879 2:84220523-84220545 GAATATCCATTTAAGAAAAAAGG - Intergenic
933607317 2:84396969-84396991 TAGTATAACTATAAGAAAAAAGG - Intergenic
933822061 2:86122284-86122306 TAAAAACATTTTTACAAAAATGG - Intronic
936918981 2:117668567-117668589 TTATATTACTTTAACACAAGAGG - Intergenic
937185826 2:120041118-120041140 TTATATTACGTTAACATAAAAGG - Intronic
937284700 2:120742668-120742690 TAGGATGACTTTAAAAAAAAAGG + Intronic
938546338 2:132335993-132336015 TAAAATTACAATAACAAAAAGGG + Intergenic
938643347 2:133305894-133305916 CAATATAACGCTAACAAAAATGG + Intronic
939163294 2:138613822-138613844 TAATACTACTTTTACATAAAGGG + Intergenic
939478669 2:142719440-142719462 CAATATAACTTAAACAGAAAAGG + Intergenic
939517241 2:143184250-143184272 TAATATGACCTCAACAAAATTGG + Intronic
939748681 2:146012195-146012217 GAATATCACTTATAGAAAAATGG - Intergenic
939941153 2:148353104-148353126 AAATATTACTTTAGTAAAAAAGG + Intronic
939968451 2:148634140-148634162 TGAAATCAAATTAACAAAAAGGG - Intergenic
940208188 2:151227690-151227712 TAATAGTACTGAAACAAAAACGG - Intergenic
940744870 2:157556013-157556035 TAAAAACTTTTTAACAAAAAGGG - Intronic
940819593 2:158337409-158337431 TAAAATCTCTTTAACAAGATTGG + Intronic
941002366 2:160215346-160215368 TATTAACACTTTAAATAAAAAGG - Intronic
942641969 2:178070235-178070257 TAATAAAAAGTTAACAAAAATGG + Intronic
943004592 2:182374723-182374745 CAATATCACTATAGCCAAAAGGG + Intronic
943244561 2:185430080-185430102 TAAAACCAATTTAACAAAAAAGG - Intergenic
943534190 2:189126675-189126697 TAATAACAGCATAACAAAAATGG + Intronic
943622084 2:190159708-190159730 AGAGATCACTTTAAGAAAAAAGG + Intronic
944297045 2:198077344-198077366 TAATAATAATTTAAAAAAAAAGG + Intronic
945232710 2:207609125-207609147 TAGTTTCACTTTAATAAAGATGG - Exonic
945709744 2:213280724-213280746 TAATTTCACTTTTACATAAACGG + Intergenic
945836806 2:214843570-214843592 AAATATGACTGGAACAAAAAGGG - Intergenic
946799600 2:223399227-223399249 AAATATCATGTTACCAAAAAGGG - Intergenic
946862378 2:224012873-224012895 TCATAAAACTTTAATAAAAATGG + Intronic
946982377 2:225231395-225231417 TAATTTTACTATAACAGAAATGG + Intergenic
948224961 2:236301767-236301789 TAATAACATTTAAAAAAAAAAGG - Intergenic
948342032 2:237261222-237261244 TAATATCACTTTCCAATAAAAGG + Intergenic
1169917688 20:10699749-10699771 CAATATCAGTTGAAGAAAAATGG - Intergenic
1170024020 20:11869092-11869114 TATAAGTACTTTAACAAAAATGG + Intergenic
1170660184 20:18330921-18330943 GAATATAGCTTTAACAAAAATGG + Intergenic
1173106652 20:40143438-40143460 TCAAATGACTTTTACAAAAAGGG - Intergenic
1173295610 20:41753120-41753142 TAATCTCTTTTTAACAGAAATGG - Intergenic
1174594482 20:51673071-51673093 TTATATCACTTTAAAAAACCAGG + Intronic
1176191745 20:63814429-63814451 TAATATAACTTTTACAAAACTGG + Intronic
1177798592 21:25805315-25805337 TAATATCAGTGTAATTAAAATGG - Intergenic
1179137260 21:38690785-38690807 TAAAATAATTTTAAAAAAAATGG + Intergenic
1179579896 21:42335886-42335908 AAATAACAGTTTAACAAAATGGG + Intergenic
1180173506 21:46074729-46074751 TAATATCAATTTAATGAGAAAGG + Intergenic
1180973545 22:19830912-19830934 TCACATCACTGGAACAAAAATGG + Intronic
1182194022 22:28495794-28495816 TAATATAAGTTTAACACAACTGG + Intronic
1183148541 22:36018095-36018117 AAAGTTCAATTTAACAAAAATGG + Intronic
1185004578 22:48268218-48268240 TATCATCACTTTAACCCAAATGG + Intergenic
949578740 3:5364985-5365007 TACCATCACTTTATCAAAAGAGG - Intergenic
951282329 3:20767307-20767329 AAATAGCTCTTTCACAAAAAAGG - Intergenic
951336048 3:21423160-21423182 TAACTTCATTTGAACAAAAATGG + Intronic
951343393 3:21516430-21516452 AAATTTCTCTTTAAAAAAAAGGG - Intronic
951493821 3:23302793-23302815 TAATATAATGTTATCAAAAACGG + Intronic
952160148 3:30685285-30685307 TAATTTCACCTTCACAAGAAGGG + Intronic
952542959 3:34387252-34387274 AAATCTCACTTTTACAACAAAGG + Intergenic
952600615 3:35077377-35077399 GAATATCACTGCAACAAACATGG - Intergenic
952675438 3:36024761-36024783 TAATATATATTTAATAAAAATGG + Intergenic
953248205 3:41216392-41216414 TACTGTCACTTTAACAGAATAGG + Intronic
953529905 3:43731133-43731155 GAAATTCACTTTAAAAAAAATGG - Intronic
955370806 3:58350077-58350099 TAATTTCAGTTGTACAAAAACGG - Intronic
955605867 3:60702472-60702494 TAGTAACAATTTAACAAAAAAGG - Intronic
956105833 3:65817784-65817806 TTTTATCACAGTAACAAAAAAGG + Intronic
956311318 3:67883820-67883842 GTGTATCACTTTAAAAAAAATGG + Intergenic
956606393 3:71077194-71077216 AAATAGAACTCTAACAAAAACGG + Intronic
956911896 3:73826788-73826810 TAACATCATTTTAAAAATAATGG - Intergenic
957268081 3:77993717-77993739 TAATTTCTCTTTAATAGAAAAGG + Intergenic
957650039 3:82989196-82989218 TAATATCTCTTTATAAAAAATGG + Intergenic
957854129 3:85851377-85851399 TAAAATCACTTTACAAACAAGGG + Intronic
958445189 3:94206416-94206438 TGATTTCACTTAAACTAAAAGGG + Intergenic
958501591 3:94917012-94917034 AAATATAACTTTCATAAAAATGG - Intergenic
958783696 3:98574050-98574072 AATTATCACTTTTACAAAATTGG + Intronic
959261089 3:104081509-104081531 AAATAACACTTTAAGAATAATGG + Intergenic
959858447 3:111189452-111189474 AGATACCACTTTAAAAAAAATGG + Intronic
959951230 3:112183246-112183268 TATTGTCAATTTAAAAAAAATGG + Intronic
960026193 3:113013429-113013451 TACTTTCACTTAAAAAAAAAGGG + Intronic
960359150 3:116689622-116689644 AAATATCACCTTAACAAGCATGG + Intronic
960359351 3:116692291-116692313 TAATATTTCTTTCAAAAAAAGGG - Intronic
960455172 3:117862467-117862489 TAATATGAAATTAATAAAAATGG + Intergenic
962015385 3:131434247-131434269 GAAAATCACCTTCACAAAAAAGG + Intergenic
962682200 3:137812057-137812079 TATTATTGATTTAACAAAAATGG - Intergenic
963372776 3:144422631-144422653 TCTTATCACTTTAATATAAATGG + Intergenic
963573690 3:147031453-147031475 TACTACCACTTTAATAAAAGTGG - Intergenic
963593642 3:147297656-147297678 TAATTTCATTTTAATAAACACGG + Intergenic
963618614 3:147575350-147575372 CAATATCTCATAAACAAAAATGG - Intergenic
964030141 3:152128864-152128886 TAATATCACATCAACATATACGG + Intergenic
964690980 3:159449391-159449413 TAATAGTGCTTTAATAAAAAAGG - Intronic
964874864 3:161355564-161355586 TTATTTCACTTCAACAACAAAGG - Intronic
965042286 3:163524902-163524924 CAATATCAATTTAACAAACGGGG - Intergenic
965084420 3:164076089-164076111 TTAAAACACTTGAACAAAAAAGG + Intergenic
965585689 3:170316101-170316123 TAATTTGTCTTTAATAAAAATGG - Intergenic
965897864 3:173599589-173599611 TAATACTAATTTAACAAATAAGG - Intronic
966342061 3:178936522-178936544 TAATAATAATTTAAAAAAAAAGG - Intergenic
966811671 3:183851849-183851871 TATTATCACATTTAAAAAAAAGG + Intronic
967147644 3:186619740-186619762 AACTATAACTTTAAGAAAAATGG + Intronic
967563407 3:190944772-190944794 TAATCTCATTTTGACACAAAAGG + Intergenic
967649574 3:191969705-191969727 TCATTTCTCTCTAACAAAAATGG - Intergenic
967801277 3:193663438-193663460 TATTCTCACATTAACAAAAGAGG - Intronic
968388942 4:172692-172714 TAGTAAAAATTTAACAAAAATGG + Intergenic
969429193 4:7144248-7144270 TTGTATCATTTTAATAAAAATGG + Intergenic
969933238 4:10654321-10654343 TATAATCACTTTAATAAATAAGG + Intronic
970353100 4:15225642-15225664 GAAGATTACTTCAACAAAAAAGG + Intergenic
971380277 4:26090746-26090768 TTATATCGCTTTAACTCAAAGGG + Intergenic
971443917 4:26721621-26721643 TAAGAACACTTTGAGAAAAATGG - Intronic
971813115 4:31453351-31453373 AAATTTCACCTTAAGAAAAAAGG - Intergenic
972063207 4:34907045-34907067 TAATAGTTTTTTAACAAAAAGGG - Intergenic
972180885 4:36463959-36463981 TAATATAATTTTCACAACAATGG + Intergenic
972184801 4:36515551-36515573 TAATATTACCTTAAAAAAGAAGG - Intergenic
972435391 4:39028960-39028982 TAGTCTAACTTTACCAAAAAAGG - Intronic
972817432 4:42659163-42659185 TATTATCACTTTATCCATAATGG + Intergenic
973565012 4:52176766-52176788 TAATGTCACTACAAAAAAAAGGG - Intergenic
973616420 4:52682895-52682917 TAAAAATACTTTGACAAAAAGGG + Intergenic
974400031 4:61391703-61391725 TACCATCAATTTAATAAAAATGG - Intronic
974945781 4:68527363-68527385 TAAAATCACTTTGATCAAAATGG - Intergenic
974955650 4:68638263-68638285 TAAAATCACTTTGAACAAAATGG - Intronic
975327363 4:73074408-73074430 TTATAGCACTTTACTAAAAAAGG - Exonic
975346167 4:73294851-73294873 TAATTTCTCTTTAATAGAAAAGG + Intergenic
975552221 4:75624876-75624898 AAATATTACTATAATAAAAAGGG + Intronic
976057823 4:81089417-81089439 AACTGCCACTTTAACAAAAATGG + Exonic
976349642 4:84046178-84046200 TAATATCATATTGACAAAAGAGG - Intergenic
976619075 4:87109837-87109859 TAAAATCACTTTAATAAAAAAGG + Intronic
976643899 4:87367593-87367615 TAATGTGTCTTTAATAAAAATGG + Intronic
976660571 4:87536172-87536194 TAAGATGACATAAACAAAAAGGG - Intergenic
977092670 4:92698266-92698288 TATTATCATTTTCACAGAAATGG + Intronic
977363570 4:96037273-96037295 TAATCTAAATTTTACAAAAAAGG - Intergenic
978998539 4:115187115-115187137 TGATATCTTATTAACAAAAAAGG + Intergenic
979625603 4:122841549-122841571 TAATATCACTTTTAATAAACTGG + Intronic
979894193 4:126137194-126137216 TAAAATATCTTTAATAAAAATGG - Intergenic
979913259 4:126397073-126397095 TAATATCATTTTAAGGAAAGAGG - Intergenic
979921934 4:126508300-126508322 TAATACCACTGAAACAAAGAGGG - Intergenic
980065420 4:128182646-128182668 TAATTTCACTTGAACAATTAGGG - Intronic
980416835 4:132500041-132500063 GAATAGCACTTCAACAAACATGG + Intergenic
980704180 4:136471609-136471631 TAAAACCACTTTAAAACAAAAGG - Intergenic
980738739 4:136923556-136923578 TAATATCTCTTAAAGAAGAAAGG + Intergenic
981414796 4:144480153-144480175 TAATCTCACTCTAATTAAAATGG + Intergenic
981505367 4:145493706-145493728 TAATATCAGCTTAACAAAAAAGG - Intronic
981743786 4:148031873-148031895 TAATATCACTGAAATAAAATGGG - Intronic
981865760 4:149416839-149416861 TAATGTGACTTGAACAAGAATGG + Intergenic
981898154 4:149829218-149829240 TAACATCACTTTACAATAAAGGG + Intergenic
982577186 4:157128300-157128322 TAATGTAACTTGAAGAAAAAAGG - Intronic
982661506 4:158212789-158212811 TAATATAACGTTAACAATCAAGG - Intronic
983658122 4:170103297-170103319 GAATATCAATTTCACAAAAAAGG + Intergenic
983722251 4:170870048-170870070 TAAGAACATTTTAAAAAAAAAGG + Intergenic
984680783 4:182606727-182606749 TAATCTCACATTAAAAAATAGGG - Intronic
984707752 4:182860321-182860343 TACTATCACCTTAACAAATCAGG + Intergenic
984750705 4:183270778-183270800 TAATTTCACATTTACATAAAAGG + Intronic
985798140 5:1980106-1980128 TAATTTCACTTCAATAAAAAAGG + Intergenic
986878629 5:12142201-12142223 TAGTATGACTTTAAAGAAAATGG + Intergenic
987751167 5:22039584-22039606 TATTCTCACTTTATCCAAAATGG - Intronic
988125385 5:27026863-27026885 AAATATGATTCTAACAAAAATGG - Intronic
988215865 5:28271727-28271749 AAAAATCACTTTAAAAAAATTGG - Intergenic
988799283 5:34681233-34681255 TAATCTCTCTGCAACAAAAATGG - Intronic
989103614 5:37840920-37840942 TAAGATCACTTTATCAGGAACGG + Intergenic
989233988 5:39122885-39122907 TAATATCACTGTAAGGTAAAAGG - Intronic
989494672 5:42099000-42099022 TAAAATCACTTAACCAGAAAGGG - Intergenic
990175309 5:53101570-53101592 AAATAGCACGTTAATAAAAAAGG + Intronic
990633285 5:57694765-57694787 AAATATGACTTTAAAACAAAAGG - Intergenic
990634090 5:57704180-57704202 TAAAATCTCATTAACAATAATGG + Intergenic
991380074 5:66011716-66011738 TTCTCTCACTTTAAAAAAAAAGG - Intronic
991387358 5:66105138-66105160 TGATATCACAGAAACAAAAAGGG + Intergenic
991499367 5:67261431-67261453 TATTCACAATTTAACAAAAAAGG - Intergenic
991542333 5:67743643-67743665 TAAATTCACTTGAACATAAAAGG + Intergenic
992332862 5:75735461-75735483 TAAAAACAGTTTAACACAAAAGG + Intergenic
992359821 5:76025728-76025750 TAATAGCACATTGAGAAAAATGG + Intergenic
993400502 5:87444382-87444404 AAATATCACTTCAACCAAGAGGG - Intergenic
994287355 5:97985455-97985477 AAATGTCACTTTAAAAATAATGG + Intergenic
994896110 5:105705341-105705363 AAAAATAAATTTAACAAAAAAGG + Intergenic
995293194 5:110484374-110484396 AAATACCTATTTAACAAAAAAGG + Intronic
995453367 5:112327058-112327080 TAATCTCAATTTCACAAATAGGG + Intronic
995919751 5:117297249-117297271 GAATATCAATTTAAGAATAAAGG + Intergenic
996590742 5:125144569-125144591 TAATTTCAGTTTTACAAATAAGG + Intergenic
996843512 5:127874492-127874514 TAAAATCAATTTATCAAAAATGG - Intergenic
996949923 5:129113215-129113237 TAAAAGCACATTAACAAAAAAGG - Exonic
998335209 5:141365584-141365606 TAATATCACTTTAACCGTCATGG + Exonic
998686474 5:144532980-144533002 TAATATATCTTAAACAAAATTGG + Intergenic
999352641 5:150889903-150889925 TAATATCACATTATATAAAAAGG - Intronic
999530225 5:152455051-152455073 TATTATCACTTCAACATAAGGGG - Intergenic
999544947 5:152617244-152617266 TAATAATAATTTAAAAAAAAGGG + Intergenic
999779828 5:154840380-154840402 AAAAATCAATTTAAAAAAAAGGG - Intronic
1000472179 5:161657763-161657785 TAATATCAATTTAACACAAAAGG + Intronic
1000550154 5:162652135-162652157 TAAAATGGCTTTCACAAAAAAGG + Intergenic
1000628872 5:163569176-163569198 TAATAAAACTTTAGCAAAAATGG - Intergenic
1000657994 5:163905363-163905385 TAATATTACTTTAAATATAAGGG - Intergenic
1000949880 5:167467640-167467662 TATTTTCACTGTAACAAATATGG - Intronic
1000961377 5:167605424-167605446 AAATATCACCTTATCCAAAAAGG + Intronic
1001747268 5:174101182-174101204 TAATATCCCTTTAACAGAAAGGG + Intronic
1001805249 5:174579056-174579078 TTATAACACTTTAATAAAAATGG - Intergenic
1003211334 6:4070401-4070423 AAAAATTACTGTAACAAAAAAGG + Intronic
1003379056 6:5605792-5605814 TAATAACCATTAAACAAAAAAGG + Intronic
1004756398 6:18615157-18615179 TCATATCACTTCAATATAAACGG - Intergenic
1005307954 6:24531817-24531839 CAAAATCCCTTTAAAAAAAAAGG - Intronic
1006531032 6:34654092-34654114 TAATACCACTTTGAAAAATAGGG - Intronic
1007058284 6:38911049-38911071 AAATATCACTTGAATGAAAATGG + Intronic
1008289436 6:49695503-49695525 TCATATCACTATACCAAAAGTGG - Intronic
1008802867 6:55391447-55391469 TCATATCACTTTAAAGACAAAGG + Intronic
1008907034 6:56689829-56689851 CAATATCAACTTAACAAAACTGG + Intronic
1010455785 6:76052793-76052815 CATTATCACTTTGAAAAAAATGG + Intronic
1010674716 6:78728799-78728821 TGAGATCACTTTAAAGAAAAGGG + Intergenic
1012060286 6:94469701-94469723 TAATGGCATTTTAACAACAAAGG - Intergenic
1012113868 6:95268619-95268641 AAATATCACTTTATCAGAAAAGG + Intergenic
1012482825 6:99687141-99687163 TACTATCACTTTAAAAATCATGG - Intergenic
1012665460 6:101962738-101962760 TAATGTTAATTTATCAAAAAAGG - Intronic
1013337913 6:109183969-109183991 TAAGATCACTTCCACAGAAAGGG + Intergenic
1013533829 6:111044925-111044947 TAAGATAACTGTAATAAAAATGG - Intergenic
1013539666 6:111095525-111095547 AATTACCACTTTAACAAATATGG - Intronic
1013824694 6:114197062-114197084 TCTTCTCATTTTAACAAAAATGG - Intronic
1014339435 6:120185435-120185457 GAATTACACTTTAGCAAAAATGG - Intergenic
1014574266 6:123050973-123050995 TCATATAATTTTAACTAAAATGG - Intronic
1014951430 6:127560325-127560347 TAAAATCACATTTACAATAATGG + Intronic
1015441515 6:133252595-133252617 AAAAATCACTTGAACAAAATGGG + Intronic
1015487327 6:133787584-133787606 AGATATTACTTTGACAAAAAGGG + Intergenic
1015682744 6:135825819-135825841 TAATTTCACTTAAAAAAAATTGG - Intergenic
1016650999 6:146460452-146460474 TAATAACATTTGAACAAAAATGG - Intergenic
1016685036 6:146871285-146871307 GAATTTCCCTTTCACAAAAAGGG - Intergenic
1017838604 6:158203057-158203079 TATTATCCCTTTCAAAAAAACGG - Intergenic
1018105155 6:160478801-160478823 GAATATCATTTTACCTAAAATGG - Intergenic
1018378711 6:163238072-163238094 TAATTTCAGTTTTACTAAAAGGG - Intronic
1018535627 6:164815942-164815964 TCATATTACTTTAAGAAGAATGG - Intergenic
1018893714 6:167999654-167999676 TTATGTCACTATATCAAAAAGGG + Intronic
1019211027 6:170405044-170405066 TAATTTCATTTTAAAATAAATGG + Exonic
1020427730 7:8088659-8088681 CAATATCAATTTCAGAAAAATGG + Exonic
1020511010 7:9057062-9057084 TAATGTCACTTTAGCCCAAAAGG - Intergenic
1021008555 7:15432588-15432610 ATATATGACTTTAATAAAAATGG - Intronic
1021013870 7:15507577-15507599 TAAAATAAATTTAACAAATAAGG + Intronic
1021588397 7:22234878-22234900 TAATAATACTTAAACACAAAGGG + Intronic
1021960704 7:25870216-25870238 TGCTATTACTTTTACAAAAATGG - Intergenic
1022123891 7:27337364-27337386 TAAAAACACTTAAACATAAAAGG - Intergenic
1022583107 7:31576869-31576891 TAAAATCATTGTAACAAAAATGG - Intronic
1022978871 7:35584267-35584289 TACTATGTCATTAACAAAAAAGG - Intergenic
1023292435 7:38682382-38682404 TAATATCACTTTTGCAAAGTTGG + Intergenic
1023608715 7:41953507-41953529 TAATACCAAATTAACAAAAAAGG - Intergenic
1023777679 7:43624062-43624084 TAATATAACTTGAAAGAAAAGGG + Intronic
1024831076 7:53458361-53458383 TTATATAACTTTAAGTAAAAAGG + Intergenic
1026076029 7:67169130-67169152 TAATATAAATATAAGAAAAAAGG - Intronic
1026599343 7:71762817-71762839 TAATAAGTCTTTAAAAAAAAAGG - Intergenic
1026700827 7:72643164-72643186 TAATATAAATATAAGAAAAAAGG + Intronic
1027474808 7:78615911-78615933 TAAAGTCACTCTAACATAAAAGG + Intronic
1027616735 7:80433285-80433307 TAATATTACTTAAAAGAAAATGG - Intronic
1028182267 7:87739194-87739216 CAATATCTCCTTGACAAAAATGG - Intronic
1028542401 7:91956963-91956985 TAAAATAAGTTTAACAAAAAAGG - Intronic
1028655277 7:93198247-93198269 TAATATCACTATATAAAATACGG + Intronic
1028795713 7:94900665-94900687 AAATATCATTCTAACAAAACAGG - Intergenic
1030090495 7:105853814-105853836 TATTGTGGCTTTAACAAAAAGGG + Intronic
1030662608 7:112238130-112238152 TAACATCACATCAACGAAAAAGG + Intronic
1030778703 7:113569911-113569933 TAATATCATAAAAACAAAAAGGG + Intergenic
1031113015 7:117634330-117634352 TAATATCAATAAAACAAAAAAGG - Intronic
1031481780 7:122286789-122286811 TACAATCACTTTAAGAAGAATGG + Intergenic
1031643236 7:124190892-124190914 TAATTTAACCTTAACAAGAAAGG + Intergenic
1031671600 7:124553891-124553913 TAATATTAGTTTAGTAAAAAAGG - Intergenic
1031787309 7:126049519-126049541 TCATATCATTTGAACAATAAAGG - Intergenic
1031968676 7:128047611-128047633 TAGTATCTCTTTCACAAAAGAGG - Intronic
1033592497 7:142823026-142823048 TAATATCCATTTAAAAAAATGGG - Intergenic
1035844337 8:2847055-2847077 TAAAATCATGTTAATAAAAATGG - Intergenic
1036023792 8:4879966-4879988 TAATATTGCTTTTACAACAAAGG - Intronic
1037612036 8:20483966-20483988 TCTTATCACTTTAACAAAGAAGG - Intergenic
1039048763 8:33473734-33473756 TAAAATAAATTTAAAAAAAAAGG + Intronic
1039231841 8:35457070-35457092 TATTATCCCTTTAACAGAGAAGG - Intronic
1040139575 8:43894569-43894591 TAATACCATTTTAACAAAAGGGG - Intergenic
1040747678 8:50665138-50665160 TAAAATCATTTTTAGAAAAAAGG + Intronic
1041113229 8:54507203-54507225 TAATCTCATTTTAAAAACAAGGG + Intergenic
1042358473 8:67855296-67855318 TAATATCACCTTATTTAAAATGG + Intergenic
1043620725 8:82189272-82189294 TAAAATCACTTTTGCAAAACAGG + Intergenic
1043627589 8:82282026-82282048 TAATATCATTATCACAAAAGTGG - Intergenic
1044104395 8:88184828-88184850 TAATTTCACTTATAGAAAAAGGG + Intronic
1044682269 8:94793431-94793453 TAAAATAAGTTTAACAAAAAAGG - Exonic
1045147139 8:99359072-99359094 TAAAATAATTTTAAGAAAAAAGG - Intronic
1045199770 8:99968178-99968200 TAACATCACATCAACAAAAAGGG + Intronic
1045522907 8:102918695-102918717 TATTATCTGTTTAAAAAAAAAGG + Intronic
1046521923 8:115336019-115336041 TGATGTGACTCTAACAAAAAGGG + Intergenic
1047021882 8:120784298-120784320 TCAAATCCCTTTAAAAAAAATGG - Intronic
1047381162 8:124364902-124364924 TAAAATAACTTGAACAAATAGGG - Intronic
1048078668 8:131101283-131101305 TAAAATCGCTTTAACAATTAAGG - Intergenic
1048788190 8:138074597-138074619 TATTATGACTTTAATAAATAAGG + Intergenic
1050072150 9:1826481-1826503 TTATATAATCTTAACAAAAATGG + Intergenic
1050143802 9:2544237-2544259 TAAAATTCCTTTAACAAATAAGG - Intergenic
1050518207 9:6468241-6468263 TGATAAGCCTTTAACAAAAATGG + Intronic
1050743787 9:8853965-8853987 TATTATCACTTTAAGAAAATAGG + Intronic
1051169797 9:14309211-14309233 TAATGACTCTTTAACAAAGAAGG + Intronic
1051390971 9:16562796-16562818 TGATATCACTTTGATAAATACGG - Intronic
1051653333 9:19352828-19352850 TAATCTTACTTTAAATAAAATGG - Intronic
1051810146 9:21039451-21039473 TACTTTCACTTTAAAAATAAAGG - Intergenic
1051985970 9:23087836-23087858 TCATATTACTGAAACAAAAATGG + Intergenic
1052191362 9:25666828-25666850 TATTATCACTTTTACACCAATGG + Intergenic
1052358826 9:27532206-27532228 TAGTTCCACTTTCACAAAAAGGG - Intergenic
1052432622 9:28386803-28386825 TAATTAGATTTTAACAAAAAAGG + Intronic
1052439322 9:28474024-28474046 TAATATTACTTTGACACAGATGG + Intronic
1052582049 9:30370533-30370555 AAATATCACTATAAAACAAATGG - Intergenic
1052654899 9:31345355-31345377 TAATATAACTTAAATAAAATAGG - Intergenic
1053330368 9:37200508-37200530 TAAAATCACTGGAAGAAAAATGG - Intronic
1053401614 9:37829114-37829136 TAATAGCCCTTTAGCAAAAGAGG + Intronic
1055542240 9:77323092-77323114 TAAGATTCCTTTAACAAAAGTGG + Exonic
1055557857 9:77493344-77493366 TAAAAGCACATTAACAAAAAAGG - Intronic
1057921273 9:99099701-99099723 TAATTTCACATAAACAACAATGG + Intergenic
1057987618 9:99733176-99733198 TTAGGTCACTTAAACAAAAATGG - Intergenic
1058256598 9:102773793-102773815 AAATATTAGTTTAAAAAAAAAGG - Intergenic
1058620993 9:106882927-106882949 TCCTATCAATTTAACAAAATTGG + Intronic
1058719450 9:107750335-107750357 TAGTATCACTTTAACCAAATGGG - Intergenic
1059045817 9:110864966-110864988 TAATATAACTATAACTAATATGG - Intergenic
1059108833 9:111535427-111535449 TTTTTTCCCTTTAACAAAAATGG - Intronic
1059629258 9:116102344-116102366 TAATATTACTTTAACTAACATGG - Intergenic
1059931102 9:119261962-119261984 TAATATCTCTTTTACAATATTGG + Intronic
1060760373 9:126242331-126242353 TTATATCATTGAAACAAAAATGG - Intergenic
1061539335 9:131269252-131269274 TATTTTCTTTTTAACAAAAATGG + Intronic
1185646634 X:1620468-1620490 TAATATAGCTTTAATAGAAAAGG + Intronic
1186042058 X:5491536-5491558 CAATTTCCCTGTAACAAAAAAGG + Intergenic
1186119579 X:6345264-6345286 TAACAAGAATTTAACAAAAATGG - Intergenic
1186948324 X:14594257-14594279 TCATTTTACTTTAAAAAAAAGGG - Intronic
1187655651 X:21469465-21469487 GAATTTAATTTTAACAAAAAAGG - Intronic
1187659409 X:21523473-21523495 AAATTTCAATTTAAGAAAAAAGG - Intronic
1187665982 X:21609707-21609729 TACTATTATTTTAAGAAAAAAGG - Intronic
1188329999 X:28858152-28858174 TGATAACATTTTAACAAATAAGG + Intronic
1188633527 X:32399534-32399556 TAATCTCACTTCAACTCAAATGG + Intronic
1188883462 X:35519216-35519238 TAATATCAGTCTAGCTAAAATGG + Intergenic
1188962556 X:36509657-36509679 TAAAATAACTTTCAAAAAAATGG - Intergenic
1189022092 X:37351046-37351068 TTATATAAATTTAACAGAAAAGG - Intronic
1189527916 X:41845808-41845830 AAATATCTATTTAACACAAAAGG - Intronic
1190553239 X:51606890-51606912 TTATTTCATTTTAATAAAAAGGG + Intergenic
1190570473 X:51776657-51776679 TAATTTCTCTTTAATAGAAAAGG + Intergenic
1190684359 X:52857608-52857630 TAATATCAGTACAAAAAAAAAGG + Intergenic
1191078156 X:56478678-56478700 AAATAGATCTTTAACAAAAAAGG + Intergenic
1191219687 X:57974968-57974990 TAATTTATCTTTAATAAAAATGG - Intergenic
1191576390 X:62710925-62710947 TACAATTACTTAAACAAAAAAGG - Intergenic
1192217733 X:69175437-69175459 TAATCTCATTTTAATAAAAAAGG - Intergenic
1192426357 X:71080424-71080446 TAATACCACTTCAAGATAAATGG + Intergenic
1192749587 X:73975582-73975604 TAATTTTACTTTCACAAAAATGG - Intergenic
1193136578 X:77978164-77978186 CAATATCACACTAACACAAAGGG - Intronic
1193179435 X:78436434-78436456 TAATTTGTCTTTAATAAAAATGG - Intergenic
1193568932 X:83117332-83117354 TAATAAAACTTGAACAAATATGG - Intergenic
1193608546 X:83599519-83599541 TAACATCACTTATATAAAAATGG - Intergenic
1193794795 X:85860418-85860440 TATTCACACTTTAAAAAAAATGG - Intergenic
1194327500 X:92538463-92538485 GAAAATCACTTTCACTAAAAGGG - Intronic
1194333712 X:92618177-92618199 AAATATCATTGTGACAAAAAAGG - Intronic
1194528326 X:95009305-95009327 TAATATGCCTTTATCAGAAATGG - Intergenic
1195304784 X:103570884-103570906 AAATCTGACTTTAATAAAAAGGG - Intergenic
1195376824 X:104235816-104235838 TAATACAACTTTAATTAAAATGG + Intergenic
1195463240 X:105151448-105151470 TAATATTATATTAACCAAAATGG + Intronic
1195546552 X:106118470-106118492 TAATTTCTCTTTAATAGAAAAGG - Intergenic
1196092239 X:111757573-111757595 TAATAGCACTTGAGCAAGAAAGG - Exonic
1196268565 X:113682838-113682860 AAATATTAATTTAAGAAAAAAGG - Intergenic
1196384600 X:115135472-115135494 TGATAAAACTTTAACAAATAAGG + Intronic
1196592827 X:117507490-117507512 AAATACCAATTTAAGAAAAAAGG - Intergenic
1196701440 X:118673645-118673667 AAATTTCACCTCAACAAAAAAGG - Intronic
1196849331 X:119922908-119922930 TCAAATAACCTTAACAAAAACGG + Intergenic
1197640009 X:128957166-128957188 ACATAGCACTTTATCAAAAATGG - Intergenic
1197796983 X:130308146-130308168 TAATTTCACTTAACTAAAAATGG - Intergenic
1198589274 X:138158771-138158793 TAATAACAATTTAAAAAAACAGG + Intergenic
1199260309 X:145765814-145765836 TAATATAAATTTTACAATAAAGG - Intergenic
1200551281 Y:4581563-4581585 TAATTTGACTTTAGTAAAAATGG - Intergenic
1200642396 Y:5737179-5737201 AAATATCATTGTGACAAAAAAGG - Intronic
1201521534 Y:14880371-14880393 TAACATAACTTGAATAAAAATGG + Intergenic
1201613067 Y:15864832-15864854 TAATGGTACTTTAACAACAAAGG + Intergenic
1201705560 Y:16932922-16932944 TAATAATAATTTAAAAAAAAAGG + Intergenic