ID: 1137335935

View in Genome Browser
Species Human (GRCh38)
Location 16:47549001-47549023
Sequence ACGTGGAAACCTTTTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137335935 Original CRISPR ACGTGGAAACCTTTTTCTTT AGG Intronic
907059551 1:51407623-51407645 ATTTGGAAACTTTTTTCTTAAGG - Intronic
907353472 1:53852781-53852803 ACTTAGAAACTTTTTTTTTTTGG - Intronic
907682307 1:56576352-56576374 AAGTGGAAACAATTTTTTTTAGG + Intronic
910903532 1:92148731-92148753 ACATGGAAACATTCTTCTTTTGG - Intergenic
912701595 1:111882210-111882232 AGGTGAAAATATTTTTCTTTGGG + Intronic
915263741 1:154699107-154699129 AAGAGGAAACATTTTTCCTTTGG - Exonic
916002484 1:160630345-160630367 TCCTTGAAATCTTTTTCTTTAGG - Intronic
917141075 1:171836668-171836690 AAGGGGAAACCTCTTTCATTTGG - Intergenic
920599439 1:207308329-207308351 AAGTTGAAACCATTTTCCTTAGG - Intergenic
921691379 1:218155207-218155229 TTGTAGAAACCTTTTTTTTTTGG + Intergenic
921811176 1:219516184-219516206 ACGTGGAAATCTTTTTTTCTGGG - Intergenic
923801638 1:237215632-237215654 ACTAGGAAACCTTTTTCTGCTGG - Intronic
924482107 1:244445115-244445137 AACTGGCAACCTTTTTCTTTAGG - Intronic
1062921517 10:1283940-1283962 AGGTGGAAACATTTGTTTTTGGG + Intronic
1064935400 10:20673520-20673542 AAGTGGAAAACATTTTCTGTGGG - Intergenic
1065127217 10:22585080-22585102 ATGTGGAACCTTTTCTCTTTTGG + Intronic
1067514118 10:46922069-46922091 ACCAGGAAATCTTTTTCTGTTGG + Intronic
1067648135 10:48129763-48129785 ACCAGGAAATCTTTTTCTGTTGG - Intergenic
1067773888 10:49147498-49147520 ACCTGGAAAGCTTTTTCTCCAGG - Intergenic
1069398479 10:68016229-68016251 GAATGTAAACCTTTTTCTTTTGG + Intronic
1070620811 10:78009396-78009418 AGGTGGAAAGTTTTTTCTTCAGG - Intronic
1074468582 10:113706357-113706379 AAGTGGCATCCTTTTTCATTTGG + Intronic
1076703587 10:132288066-132288088 ACCTTGACACCTTTTTTTTTGGG - Intronic
1077985533 11:7347666-7347688 AAGAGGAAACCTTTTCCTCTAGG - Intronic
1078942590 11:16024449-16024471 ATCTAGAAACTTTTTTCTTTAGG + Intronic
1079197335 11:18341018-18341040 ACTTCAAAACCTTATTCTTTTGG + Intronic
1081707764 11:45195082-45195104 GCATGGAAACCTGTTTCTTTAGG + Intronic
1083237911 11:61363596-61363618 TCCTGGAAAGCTTTATCTTTAGG - Intronic
1088045621 11:105447719-105447741 AAGTAGAAAGCTTTTTCTATAGG + Intergenic
1088397004 11:109379980-109380002 ACCTGAAAACCTGTTTTTTTTGG + Intergenic
1088475326 11:110232137-110232159 ACTGTGAAACCTTTTTCTTTAGG + Intronic
1090310887 11:125737599-125737621 TCGTAGATCCCTTTTTCTTTAGG - Intergenic
1092200741 12:6581028-6581050 ATGTGGATACCTTTACCTTTGGG + Exonic
1093843228 12:23932056-23932078 TCATGGAAACTTTTTTTTTTTGG - Intronic
1094361510 12:29636527-29636549 CCGTGAAAGCATTTTTCTTTTGG - Intronic
1094465853 12:30753957-30753979 GTGTGGAAAGCTTATTCTTTTGG - Exonic
1094579875 12:31724781-31724803 AAGAGGAAACCATTTACTTTGGG - Intronic
1095189048 12:39234834-39234856 ACCTGGAGATCTTTTTTTTTTGG - Intergenic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1096498566 12:52052340-52052362 AGGTGGAAACCCTTGTCCTTGGG + Intronic
1099080726 12:78177079-78177101 ACTTGGAGAGCTTTTGCTTTGGG - Intronic
1100741173 12:97595300-97595322 AAGTGGGAACCTTTTGTTTTGGG + Intergenic
1107323952 13:39220171-39220193 AAGGGGAAACCCTTTTCATTTGG - Intergenic
1109239459 13:59866815-59866837 ACGTAGATACCTTTATTTTTAGG - Intronic
1109366357 13:61361837-61361859 ACCTTCAAACCTTTTTTTTTTGG + Intergenic
1111352932 13:87055797-87055819 AAATGTAAACCATTTTCTTTTGG - Intergenic
1111661437 13:91217377-91217399 ACGTAGAAGTCCTTTTCTTTAGG - Intergenic
1112289030 13:98128685-98128707 AAGGGGAAACCCGTTTCTTTTGG + Intergenic
1113270838 13:108672327-108672349 AAATGGAAACTTTTTTCTTATGG - Intronic
1115267913 14:31520523-31520545 ACATGAAAAGCTTTTTATTTTGG + Intronic
1116748721 14:48853549-48853571 CTGTGGAACCCTTTTTTTTTTGG - Intergenic
1117755471 14:58970315-58970337 ACGTGGCCACCTTTGTATTTAGG - Intergenic
1118108916 14:62694176-62694198 AGGTGGAAGCCTTTTTCACTGGG + Intergenic
1118698969 14:68414299-68414321 AGCTGGAAAACATTTTCTTTTGG + Intronic
1120463678 14:84828294-84828316 CTATGAAAACCTTTTTCTTTTGG - Intergenic
1126929869 15:53635552-53635574 AAGTGGAAACCATTATCTTAAGG + Intronic
1127966193 15:63924545-63924567 AGTTGAAACCCTTTTTCTTTGGG - Intronic
1128578897 15:68795285-68795307 ACGTGGATGCTTTTTTCTTGGGG - Intronic
1128947247 15:71835207-71835229 AGGTTGAAAGCTTTTCCTTTGGG + Intronic
1130038833 15:80386674-80386696 ACGCGGCAACCATTTTCTCTGGG - Intronic
1131826432 15:96325412-96325434 AGGAGGAAATCTATTTCTTTTGG - Intergenic
1132082939 15:98882993-98883015 TCTTGAAAACCTTTTTATTTAGG + Intronic
1135789261 16:25378456-25378478 AGGTGGAAATCGTTTGCTTTTGG + Intergenic
1137335935 16:47549001-47549023 ACGTGGAAACCTTTTTCTTTAGG + Intronic
1138892517 16:61162478-61162500 ACGTGGAGACCTTTTTAGTGAGG - Intergenic
1139015077 16:62679742-62679764 ATGTGGGAACTTGTTTCTTTTGG - Intergenic
1140852789 16:78950654-78950676 AGGTGGAATCCTTTTTCCTTGGG + Intronic
1142608043 17:1092827-1092849 ACGTCGAATTCTTTTTTTTTTGG + Intronic
1142707918 17:1708291-1708313 GCGTGGAAGCCTCTTTCTTCAGG - Intronic
1143068159 17:4266117-4266139 ACGTGTAAGCCTTTTTGTTGTGG + Intergenic
1143069440 17:4278198-4278220 CCATGGAAACCTGTTTCCTTAGG - Intronic
1148645093 17:49215484-49215506 ACATGGAAAGCTTTTTTTTTTGG + Intronic
1150495067 17:65601507-65601529 ATGTGGAAACCCTTTGCCTTGGG - Intronic
1155856238 18:30838701-30838723 ATGTGGAAGCTTTGTTCTTTCGG - Intergenic
1156075719 18:33276578-33276600 CCTTGGAAACCTTTTTCTTTTGG - Intronic
1156441804 18:37197691-37197713 ATGTGGAAATGTTTTTCTTGGGG - Intronic
1156989836 18:43395733-43395755 ACCTATAAACCTTTTTCTTAAGG - Intergenic
1157060955 18:44289804-44289826 CAGTGGATACATTTTTCTTTTGG - Intergenic
1158757980 18:60349561-60349583 ACTTGGACATTTTTTTCTTTGGG + Intergenic
1163250153 19:16122033-16122055 AAGTGGAAACATAATTCTTTGGG + Intronic
1163971866 19:20806019-20806041 ACATTGAAACATTTTGCTTTGGG - Exonic
1165648052 19:37461127-37461149 ACGAGGAAAATTTTTTCTTTAGG + Intronic
928535513 2:32236358-32236380 ACCTGAAAATCTTTTTATTTTGG - Intronic
930146437 2:48011134-48011156 AAGTGGAACTCTTTTACTTTTGG + Intergenic
930950376 2:57135576-57135598 AGATGGAAAGCTTTTTTTTTTGG + Intergenic
931044617 2:58336870-58336892 ATGAGGAAATTTTTTTCTTTTGG - Intergenic
938992323 2:136642203-136642225 AAGGGGAAACCTGTTTCTCTTGG - Intergenic
940256011 2:151729943-151729965 ACATGGAAATTTTTTTCTTATGG + Intronic
940940484 2:159554841-159554863 CCCTGGAAAAGTTTTTCTTTAGG + Intronic
942394167 2:175528655-175528677 ACTTGGAGGCTTTTTTCTTTTGG + Intergenic
942928642 2:181462719-181462741 AGGTGGAAACCTCATCCTTTTGG - Intronic
943379256 2:187122464-187122486 CTGTGGAAACATTTTTCTTTTGG + Intergenic
945348150 2:208744296-208744318 AACTGGAAACCATTGTCTTTAGG - Intronic
947014570 2:225604278-225604300 ACGTACAAAACTTCTTCTTTTGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172357452 20:34290168-34290190 ACGTGGCAACCTTATCCTGTGGG - Intronic
1176872096 21:14092327-14092349 CCGTGGAAGCTTTGTTCTTTCGG - Intergenic
1178480152 21:32973487-32973509 TCATGGAAACCTTGCTCTTTGGG + Intergenic
1178584395 21:33860352-33860374 AAGTTAAAACCTTTTTCCTTGGG + Intronic
1179000169 21:37450336-37450358 ATGTGGGAACCTTTTTCATCAGG + Intronic
1179126276 21:38594031-38594053 ACAAGGAAACCTTTTCCTGTTGG - Intronic
949122921 3:409240-409262 ACGTGATTACCTTTTTCTTTTGG + Exonic
949322831 3:2830468-2830490 ACATGCAGAGCTTTTTCTTTTGG + Intronic
949671922 3:6407881-6407903 ACAGGAAAACATTTTTCTTTAGG - Intergenic
950854656 3:16093814-16093836 GCGTGGCAACCTTTGTCTTTAGG + Intergenic
951588052 3:24235335-24235357 ACGTGGAAAGATTTTTCATGAGG - Intronic
952013244 3:28926693-28926715 TTGTGGGAACATTTTTCTTTTGG + Intergenic
953711160 3:45272468-45272490 CTGTGGAAAGGTTTTTCTTTAGG - Intergenic
954371215 3:50170452-50170474 ACGTGGAAGCCTGCTTCCTTGGG + Intronic
954408044 3:50356298-50356320 ATGTGTAAACCTTCTTCTGTTGG - Intronic
957337757 3:78853855-78853877 ATGGGGAAACCCTTTTCTCTTGG - Intronic
959873310 3:111352889-111352911 AAGTGGAAACCCCTTTCTCTTGG + Intronic
960275392 3:115723088-115723110 ACTTTCTAACCTTTTTCTTTAGG - Intergenic
961948014 3:130714212-130714234 TCCTGGAGAGCTTTTTCTTTGGG - Intronic
962332686 3:134493467-134493489 ACATGGGAACCTTTTTCTTTAGG + Intronic
966040711 3:175484141-175484163 AAGAGGAAACATTTTACTTTTGG - Intronic
967284845 3:187859017-187859039 GCCTGGATACCTTTTGCTTTAGG - Intergenic
970929958 4:21498253-21498275 ACCAAGAAACTTTTTTCTTTTGG + Intronic
971235257 4:24836027-24836049 ACTCGGAAACCATTTTCTTATGG + Intronic
973135785 4:46704624-46704646 AAGTGGAATAGTTTTTCTTTGGG - Intergenic
973345883 4:49055089-49055111 AAGTTGAAAGCTTTTTCTCTGGG - Intronic
976502988 4:85814028-85814050 AAGGGGAAACCTATTTCTCTTGG - Intronic
976504726 4:85833347-85833369 AATTGGAAAGGTTTTTCTTTAGG + Intronic
976818819 4:89181364-89181386 TAGTCAAAACCTTTTTCTTTAGG + Intergenic
977993867 4:103478737-103478759 AGGATGAAACATTTTTCTTTAGG - Intergenic
981532659 4:145766924-145766946 ACCTGGAAACCTCGTTCCTTTGG - Intronic
982128438 4:152204818-152204840 AGGATGACACCTTTTTCTTTTGG + Intergenic
982924597 4:161320078-161320100 AAGGGGAAACCTCTTTCTTTTGG - Intergenic
983294368 4:165847224-165847246 ACCTGAAAATCTTTTTTTTTTGG - Intergenic
983461476 4:168029625-168029647 ACAATGAGACCTTTTTCTTTTGG - Intergenic
985419705 4:189772518-189772540 AGGTGCATACCTTATTCTTTTGG + Intergenic
986919154 5:12662772-12662794 GTGTAGAAACCTTGTTCTTTCGG + Intergenic
987080410 5:14420588-14420610 AAGTGGACACCTTTGGCTTTTGG - Intronic
988137677 5:27195886-27195908 ACATTCAAAACTTTTTCTTTTGG + Intergenic
988403795 5:30797789-30797811 ATGTGAAAACATTTTTCATTAGG - Intergenic
989990429 5:50757508-50757530 ACCTGGAAACATTTTTATTTGGG + Intronic
990209723 5:53469553-53469575 ACTTGGAAAGCTTTTCCTTTAGG - Intergenic
990809531 5:59706869-59706891 ATGTGGATACCATTTTCTTTAGG - Intronic
991066854 5:62433081-62433103 CTGTGGGAACCTTTTTATTTTGG + Intronic
994117299 5:96074959-96074981 CCCAGGATACCTTTTTCTTTAGG + Intergenic
994272927 5:97802995-97803017 ACCTGGAAATTTTTTTGTTTGGG - Intergenic
994389138 5:99169264-99169286 AAGCAGAATCCTTTTTCTTTTGG + Intergenic
995589307 5:113682710-113682732 ACATGGAATCCTTTTTACTTTGG - Intergenic
999369784 5:151047682-151047704 ACCTTTAAACCTTTTTATTTTGG - Intronic
999831863 5:155327998-155328020 ATGAGGAAAAATTTTTCTTTTGG + Intergenic
1003012789 6:2441610-2441632 AAGGGGTAACATTTTTCTTTAGG - Intergenic
1004452248 6:15758153-15758175 CCGTGGAAGCTTTGTTCTTTTGG - Intergenic
1006280419 6:33048408-33048430 AAGTTGAAAGCTTTTTCTTTAGG - Intergenic
1008680054 6:53862562-53862584 AGGTGAAAACCTTTTTGATTAGG + Intronic
1010595820 6:77762808-77762830 AAATGGAAATCTTTTTCTTTTGG + Intronic
1011019498 6:82796402-82796424 ATGTAGAAATATTTTTCTTTTGG - Intergenic
1011470165 6:87701173-87701195 ACAGGGACATCTTTTTCTTTGGG - Intronic
1011507087 6:88057362-88057384 TCATGGAATCCTTTTTCTTATGG + Intronic
1012389735 6:98723957-98723979 GCATGGAAAGCTTTGTCTTTGGG - Intergenic
1012455537 6:99399837-99399859 AAGTAAAAACCATTTTCTTTGGG + Exonic
1012810753 6:103954697-103954719 ATGTGGAATACTTTTACTTTAGG - Intergenic
1013384643 6:109613934-109613956 ACATTCAAACATTTTTCTTTGGG + Intronic
1013542047 6:111120839-111120861 ACTTGGAAACATTTATCTTAAGG + Intronic
1014322546 6:119948485-119948507 ACGTGGAGAGCTTTTGCTGTGGG + Intergenic
1014400087 6:120977569-120977591 ACGTGGAATACATTTTGTTTTGG + Intergenic
1015626079 6:135181780-135181802 ATGGGGATACATTTTTCTTTAGG + Intronic
1016428863 6:143962394-143962416 ACTCGGAAACATTTATCTTTAGG - Intronic
1016708935 6:147147095-147147117 ACTTATAAACCTTTTTCTCTGGG - Intergenic
1018566239 6:165157000-165157022 AGGTAGACACATTTTTCTTTTGG - Intergenic
1019268631 7:133713-133735 ACCTGGAGCCCTTTTTCTTGAGG + Intergenic
1021703632 7:23345204-23345226 ACGTGGAAAGGTTTTTCTGAGGG - Intronic
1022740197 7:33113055-33113077 AGGTGGAAACCTTTTTTTTAGGG + Intergenic
1027520987 7:79207128-79207150 ATGTTGAAAGCTTTTCCTTTAGG + Intronic
1028958377 7:96720629-96720651 AAGGTGAACCCTTTTTCTTTTGG - Intergenic
1032965312 7:137090661-137090683 ATGTGCAAATCTTTTTCTCTTGG + Intergenic
1035594624 8:846451-846473 AAGTGGAATCCTTTCACTTTGGG - Intergenic
1038997219 8:32937477-32937499 ACTTTGTAACCTTTTTTTTTAGG - Intergenic
1040130319 8:43788262-43788284 AATTGGAAACCGTTTTTTTTTGG + Intergenic
1042875988 8:73440416-73440438 ACGGGGACACCATTTTCTTAGGG - Intronic
1043587447 8:81785520-81785542 TCTTGGAAACATTTTTCTTTTGG - Intergenic
1045413087 8:101939082-101939104 AAGTAGAAGACTTTTTCTTTTGG - Intronic
1045799393 8:106084602-106084624 AAGTGGAAACCTCTTTGTTGTGG - Intergenic
1045884841 8:107083615-107083637 ATGTGGAAAACCTTTTCTTTTGG + Intergenic
1048185459 8:132236218-132236240 AAGGGCAAACCTTTTTCATTTGG + Intronic
1051419451 9:16875289-16875311 GGGGGGAAAGCTTTTTCTTTTGG + Intergenic
1052030159 9:23619413-23619435 ACTTGGAAACCATGTGCTTTGGG + Intergenic
1053091073 9:35277249-35277271 AGATGGCATCCTTTTTCTTTGGG + Intronic
1055248432 9:74275339-74275361 TTGTGGAAACTTTGTTCTTTAGG - Intergenic
1055964016 9:81847704-81847726 ACGGGGAAAACGTTTTCTTTGGG - Intergenic
1060497364 9:124128359-124128381 AGGGGAAAACCTATTTCTTTAGG + Intergenic
1203781411 EBV:103001-103023 TGTTGGAGACCTTTTTCTTTAGG - Intergenic
1189565824 X:42240103-42240125 GCCTGGTAACCTTTTTCTGTTGG - Intergenic
1190577106 X:51850988-51851010 ACGTGGAATCCTTTGTATTAAGG + Intronic
1197038234 X:121903894-121903916 ACTTCTAAGCCTTTTTCTTTTGG + Intergenic
1197562237 X:128037638-128037660 ACGTTGTATCCTATTTCTTTTGG - Intergenic
1198113558 X:133523704-133523726 ACATGAAGACCTTTTTCCTTAGG + Intergenic
1200769889 Y:7113988-7114010 ACGTGGAAATTTAATTCTTTGGG + Intergenic
1200946024 Y:8838909-8838931 AAGGGGAAACCCTTTTCTCTTGG + Intergenic
1201403195 Y:13625335-13625357 TCAAGGAAATCTTTTTCTTTTGG + Intergenic