ID: 1137337653

View in Genome Browser
Species Human (GRCh38)
Location 16:47566167-47566189
Sequence GTATTGGGATGGCCCATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137337653 Original CRISPR GTATTGGGATGGCCCATGCA GGG (reversed) Intronic
902259260 1:15212236-15212258 GTATTGGGATGGCAATTTCATGG - Intronic
906199133 1:43947902-43947924 GTCTTGGGATGGTCCCTTCAGGG + Intronic
907921959 1:58922333-58922355 GTGCTGGGATGGCCCACACAGGG + Intergenic
908519027 1:64923117-64923139 GGATTGGGATGGGCCTTGAAGGG - Intronic
911481015 1:98440297-98440319 GTAAAGGGATGGGCCAGGCATGG + Intergenic
912154355 1:106898993-106899015 GTATTGGGATGGCCTAATCTGGG - Intergenic
912527173 1:110292022-110292044 GTCTTGGGCTGGCAAATGCAAGG - Intergenic
914900913 1:151710584-151710606 GGGATGGGATGGCCCCTGCAGGG - Intronic
1064054711 10:12087665-12087687 TTATTGGGATGCCCCATAGAGGG + Exonic
1064967459 10:21029718-21029740 GTATCGGGATGGCCCATGCCGGG + Intronic
1068028334 10:51677019-51677041 TTATTGGGAGGGCACATACAGGG - Intronic
1068734093 10:60392595-60392617 GGATGGGCGTGGCCCATGCACGG + Intronic
1072246221 10:93546650-93546672 GTATTAGGATGGGCCAGGCTAGG + Intergenic
1077485288 11:2835715-2835737 GTACTGGGAGGGCCCTGGCAAGG + Intronic
1078452225 11:11448978-11449000 GGATTGTCATGGCACATGCAGGG - Intronic
1086274329 11:85107426-85107448 GTATGGCTATGGCCCATGCATGG - Intronic
1088035039 11:105301060-105301082 GAATGGGGAAGGCCCATGTAAGG + Intergenic
1088392698 11:109332641-109332663 GTTTTGGGAAGGCCGATGCAGGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1096644969 12:53027834-53027856 GTATCGGGATGGCCCACGCCGGG + Exonic
1099205491 12:79721696-79721718 GAAATGGTGTGGCCCATGCATGG + Intergenic
1101030939 12:100659410-100659432 GTATTAGGATAGTCCATGCAAGG + Intergenic
1102259627 12:111436271-111436293 GTCCTGGGATGGGCCTTGCAAGG - Intronic
1102422614 12:112815926-112815948 GTAATTGGCTGGACCATGCAGGG + Intronic
1104911021 12:132241036-132241058 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911047 12:132241126-132241148 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911077 12:132241216-132241238 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911107 12:132241306-132241328 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1104911168 12:132241486-132241508 GTATAGGGAGGGCCCCTGGAAGG - Intronic
1105485026 13:20819929-20819951 CTAATGGGGTGGCCCAGGCATGG - Intronic
1107894584 13:44948430-44948452 GTAATTGGATGGGCCAGGCACGG - Intronic
1122837757 14:104438347-104438369 GCCATGGGATGGCCCATGCCAGG - Intergenic
1122887765 14:104718171-104718193 CCAGTGGGATGGCCCAAGCAGGG - Intronic
1124404514 15:29381874-29381896 GTGTTTTGATTGCCCATGCAAGG - Intronic
1126514344 15:49518793-49518815 GTTTTGGGAGGGGCCAGGCATGG - Intronic
1132198795 15:99933377-99933399 GTGGTGGGGTGGCCCATGCTGGG + Intergenic
1133811261 16:9162741-9162763 GTATTTGAGTGTCCCATGCATGG + Intergenic
1137337653 16:47566167-47566189 GTATTGGGATGGCCCATGCAGGG - Intronic
1140804511 16:78520710-78520732 GTACAGGGGTGGCCAATGCAGGG - Intronic
1141352451 16:83310714-83310736 CTATTGTGCTGGTCCATGCATGG - Intronic
1143397137 17:6609762-6609784 GTGTTGGGGTGGCCCATGGAAGG + Intronic
1144204175 17:12967537-12967559 GTATTGTGATGGGGCAAGCAAGG - Intronic
1146438280 17:32871869-32871891 GTATAGGAATGGCCCATGTAAGG + Intronic
1149867778 17:60160249-60160271 GTGTGGGGATGGCCTAGGCAAGG + Intronic
1150271182 17:63866383-63866405 GTATAGAGCTGCCCCATGCAGGG + Intergenic
1152400673 17:80064684-80064706 GTAAGGGCTTGGCCCATGCAGGG - Intronic
1152436357 17:80278646-80278668 CTCTTGGGAAGGCCCAGGCAGGG - Intronic
1152790104 17:82274044-82274066 GTACTGGGATGCCCCAAGCCCGG - Intergenic
1152912128 17:83010907-83010929 GCACTGGGATGGAGCATGCAGGG - Intronic
1159246328 18:65809949-65809971 ATTTTTGGATGGCCCATACACGG + Exonic
1162906743 19:13828585-13828607 GTCTTGGGCTGGCCTATGGAGGG - Intronic
1166289722 19:41854780-41854802 ATCTTGTGAAGGCCCATGCAGGG - Intergenic
1166298092 19:41898394-41898416 TTCTTGGGATGGCCCAAGCTGGG + Intronic
935652236 2:105392116-105392138 GTCTGGGGATGGCCCAGGGAAGG + Intronic
936059946 2:109287994-109288016 GCCATGGGATGGCCCATGCCAGG - Intronic
1175932454 20:62499030-62499052 GTATTGGGATGGCCGCTGGAGGG + Intergenic
1178772513 21:35518867-35518889 TTATTGGAATGTCCCACGCAGGG - Intronic
1180833130 22:18916257-18916279 GTATTCGGATGGCTCCTGAAAGG - Intronic
1181066695 22:20309992-20310014 GTATTCGGATGGCTCCTGAAAGG + Intergenic
1203283214 22_KI270734v1_random:141561-141583 GTATTCGGATGGCTCCTGAAAGG - Intergenic
950534040 3:13569252-13569274 GGGTTGGGATGGCTCCTGCAGGG + Intronic
953083305 3:39641797-39641819 TTCTTGGGATGGCCCTTGAAGGG + Intergenic
954363561 3:50134756-50134778 GTGTGGGGATGTCCCATGTAGGG + Intergenic
955146172 3:56322401-56322423 GAATTGGGATGGCCCTGGAATGG + Intronic
960912257 3:122661327-122661349 GTATCAGGATGGCCCACGCTGGG + Intergenic
962492895 3:135910868-135910890 GTATTTGGATGTCACATACATGG - Intergenic
962929035 3:140020611-140020633 GTCCTGGGATGGCAAATGCAAGG + Intronic
969592555 4:8130278-8130300 GTTCCGGGATGGCCCATGCTGGG + Intronic
976147276 4:82054481-82054503 AAATTGGGATGGGCCAGGCATGG + Intergenic
988619830 5:32811662-32811684 GTCTTGGAATGGGGCATGCAGGG + Intergenic
997735783 5:136211671-136211693 GGGTTGGGAAGGCCCAGGCATGG + Intergenic
997879296 5:137574988-137575010 GTCATGGGATGGCCCATCTAGGG - Intronic
1007812637 6:44497197-44497219 CCATTTGGGTGGCCCATGCAGGG + Intergenic
1008913655 6:56763379-56763401 ATATAGGGATGGGCCAGGCATGG + Intronic
1009523153 6:64710371-64710393 GTGAAGGGATGGCCCATGCTTGG - Intronic
1013091309 6:106903126-106903148 GACCTGGGATGGCCCAGGCATGG + Intergenic
1016081348 6:139861429-139861451 AGATTAGTATGGCCCATGCAGGG + Intergenic
1019378321 7:708063-708085 GTATTGGGATGGCTAATTCTGGG - Intronic
1019378349 7:708175-708197 GTATTGGGATGGCTCCTTCTGGG - Intronic
1019378365 7:708254-708276 GTATTGGGATGGCTCCTTCTGGG - Intronic
1019931483 7:4226222-4226244 GTATTGGGAGGGGCCACACAGGG + Intronic
1022189986 7:28007849-28007871 GTAATGGGAGAGGCCATGCATGG - Intronic
1024294704 7:47832939-47832961 GTTTTGGGTGGGCCCATGCCTGG + Intronic
1029694285 7:102202776-102202798 GCTTGGGGATGGCCCAAGCAGGG + Intronic
1029958831 7:104668456-104668478 GTATCGGGATGGCCCACGCCGGG + Intronic
1033009585 7:137606162-137606184 GTATTGGGATGAACCGTGTAAGG - Intronic
1033613710 7:142990808-142990830 GTATTAGTACTGCCCATGCAAGG + Intergenic
1036778158 8:11627950-11627972 GTATTGGGATGGACCCCGTAGGG - Intergenic
1045639290 8:104229799-104229821 GTATTGGGATGGACCAAACTGGG - Intronic
1048709826 8:137197136-137197158 GTATAGGGATCTCACATGCAGGG + Intergenic
1052673219 9:31584993-31585015 GTATTGAGATGGAACATGAAAGG - Intergenic
1056561186 9:87731136-87731158 GACTGGGGATGGCGCATGCATGG + Exonic
1057563401 9:96146726-96146748 GTATCGGGATGGCCAACGCCGGG + Intergenic
1059557641 9:115297357-115297379 GCACATGGATGGCCCATGCAAGG + Intronic
1061817832 9:133207040-133207062 GGAATGGGATGGGCCAGGCAGGG - Intronic
1187745648 X:22406363-22406385 GTCTTGGAATGGACCATGCCTGG - Intergenic
1188145965 X:26613788-26613810 GTATTGGGATGGTATATGTAGGG - Intergenic
1191904637 X:66075625-66075647 GTATTGGGATGGCCCACACTGGG - Intergenic
1195266045 X:103180851-103180873 GTAGTGAGATGGCTCTTGCAGGG - Intergenic
1196080003 X:111620769-111620791 GTATCGGGATGGCCCACGCCGGG - Intergenic
1196158655 X:112458359-112458381 AAATTGGGATGGCCATTGCAGGG - Intergenic
1197856250 X:130916858-130916880 GGGCTAGGATGGCCCATGCACGG + Intergenic