ID: 1137338752

View in Genome Browser
Species Human (GRCh38)
Location 16:47577028-47577050
Sequence GCATCAGCTAAGTTAAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137338752 Original CRISPR GCATCAGCTAAGTTAAGAAA AGG (reversed) Intronic
901045236 1:6392364-6392386 GCATGAGCTAAGTGAGGACAAGG - Intronic
902622256 1:17657334-17657356 GCATCATCTCAGTAAAGCAAAGG - Intronic
907716919 1:56934644-56934666 GCATCAGATGCATTAAGAAATGG - Intronic
908487486 1:64609735-64609757 ACATTTGCTAAGTTAAAAAAAGG - Intronic
909859553 1:80587714-80587736 TCATCATCTAAGTTAAGTATGGG + Intergenic
910373724 1:86546528-86546550 GCAGCAGCCAATTTCAGAAATGG + Intergenic
911775033 1:101798505-101798527 GCAGTAGCTAATTTCAGAAAAGG + Intergenic
912937123 1:114013297-114013319 GCATCAGCTTTGTTAAGTAAGGG - Intergenic
913005360 1:114625072-114625094 GCATCACCTAAGCTGGGAAATGG + Intronic
913447687 1:118967556-118967578 CCATCAGTTAAGTGAAGGAAAGG + Intronic
919173261 1:193985846-193985868 ACATCAACTAAAATAAGAAAGGG - Intergenic
919959779 1:202455012-202455034 GTAACAGCTAAGTGAAGAGAAGG + Intronic
921565051 1:216706740-216706762 GCATCAGTTAAGTTTATAGAAGG - Intronic
923269752 1:232344998-232345020 GCATCATCTAGGTCAATAAAAGG + Intergenic
1065488973 10:26263467-26263489 GTATCAGCTATGTAAAGACACGG + Intronic
1066187807 10:33027494-33027516 TCATCAGCAAAGTGAGGAAATGG + Intergenic
1066628393 10:37433296-37433318 GAATTAGTTAATTTAAGAAAAGG - Intergenic
1069388792 10:67910501-67910523 GCATCAATTAATTTATGAAATGG + Intronic
1069925208 10:71845360-71845382 GCAACACCCAGGTTAAGAAATGG - Intronic
1070998600 10:80809023-80809045 TCATCAACTAAGTGAAGATAGGG - Intergenic
1072971658 10:100022758-100022780 GCATTAGCTAAGTTAATCAAAGG + Intergenic
1073571453 10:104583991-104584013 CCATCAGCAAAGTTAACACAAGG - Intergenic
1074881187 10:117660613-117660635 GCATCAGCCAAGGAAAGAAAAGG - Intergenic
1076066531 10:127452814-127452836 TCAGCTGCTAATTTAAGAAAGGG + Intergenic
1078968753 11:16379851-16379873 TGATCAGCTAAGCTATGAAATGG + Intronic
1079742655 11:24082931-24082953 GTTTCAGCTAAGTGAAGGAAAGG - Intergenic
1079950638 11:26799009-26799031 GCAGCAGCTACAATAAGAAAAGG - Intergenic
1080164024 11:29215188-29215210 GCATCAGCTGTTTAAAGAAAGGG - Intergenic
1081233216 11:40612710-40612732 ACATCAGCCAAGTGATGAAAGGG - Intronic
1081279075 11:41186237-41186259 GCATCAGCACAGTAATGAAAAGG + Intronic
1083650038 11:64197691-64197713 GAATCTGCTGTGTTAAGAAAGGG + Intronic
1083868451 11:65471641-65471663 TCATCTGCCAATTTAAGAAATGG + Intergenic
1083976325 11:66124272-66124294 GAATTAGCTAAGTGAAGAGAAGG + Intronic
1084338186 11:68474455-68474477 GCATTAGGTAAGTTAAAAACAGG - Intronic
1085291390 11:75402505-75402527 TCATCTGCTAAATTAACAAATGG - Intronic
1085843401 11:80039375-80039397 GCATCAAGTAAATTCAGAAAGGG - Intergenic
1089119528 11:116124028-116124050 GCATTTGCTAAGTTAGAAAATGG - Intergenic
1089416849 11:118299252-118299274 CCATCCCCTCAGTTAAGAAAGGG + Intergenic
1092011045 12:5112868-5112890 GCATCACCTCAGGAAAGAAAGGG - Intergenic
1092924341 12:13259889-13259911 TCATCAGTTAAGGTAAGAACAGG + Intergenic
1098334236 12:69385806-69385828 GTATTAAATAAGTTAAGAAATGG - Intronic
1099024003 12:77443016-77443038 GCCTCAGCCAAATTAAGGAAAGG + Intergenic
1107789881 13:43991066-43991088 GCATCAGCTTCTTTAATAAATGG + Intergenic
1109380008 13:61547123-61547145 GCTTCAACTGAGTTGAGAAATGG - Intergenic
1109471768 13:62816396-62816418 GCTTGAGCTAAGGTAAGAAGAGG - Intergenic
1113983729 13:114297240-114297262 ACCTCAGCTAACTTGAGAAAAGG - Intronic
1116291393 14:43047001-43047023 GAATCATTTGAGTTAAGAAAAGG - Intergenic
1116490089 14:45495228-45495250 TCATCAGCTAAGGCAAGAACTGG + Intergenic
1120143780 14:80957179-80957201 GCATTAGCTGGGTGAAGAAATGG - Intronic
1121165766 14:91796524-91796546 TGATCAGTGAAGTTAAGAAAAGG + Intronic
1122736315 14:103845008-103845030 GGATATGCTAAGTTAATAAAAGG + Intronic
1126258531 15:46657749-46657771 TCATCAGCTCAGCTGAGAAAAGG + Intergenic
1127062886 15:55205530-55205552 GGATCAGTTAAGTGAAGAAAAGG - Exonic
1128512447 15:68321712-68321734 CCATCAGCTCAGTTATGAACTGG - Intronic
1128660948 15:69500638-69500660 CCATTAGTTAAGTTAAGATAAGG - Intergenic
1136708867 16:32216547-32216569 GCTACAGATAATTTAAGAAACGG - Intergenic
1136759041 16:32712877-32712899 GCTACAGATAATTTAAGAAACGG + Intergenic
1136809066 16:33157507-33157529 GCTACAGATAATTTAAGAAACGG - Intergenic
1136815542 16:33267587-33267609 GCTACAGATAATTTAAGAAACGG - Intronic
1137338752 16:47577028-47577050 GCATCAGCTAAGTTAAGAAAAGG - Intronic
1138012391 16:53394609-53394631 GTAGAAGGTAAGTTAAGAAAGGG + Intergenic
1139023888 16:62789130-62789152 ACATAAGCTGAGATAAGAAAAGG + Intergenic
1139038557 16:62977064-62977086 GCCACAGCTAAGTTGTGAAAAGG + Intergenic
1140330781 16:74054814-74054836 ACATATGCTAAGTTAGGAAAGGG + Intergenic
1203061199 16_KI270728v1_random:973211-973233 GCTACAGATAATTTAAGAAATGG + Intergenic
1142813298 17:2406626-2406648 GCATCAGCTAGGTTGAGAAGTGG + Intronic
1149241087 17:54650439-54650461 TCATCATCTAAGGGAAGAAATGG - Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153824623 18:8864203-8864225 ACAACAGCAAAGTTAATAAAAGG - Intergenic
1155128541 18:22904912-22904934 TCATTATCTCAGTTAAGAAAAGG - Intronic
1157059427 18:44270362-44270384 ACATCAGCTATTTAAAGAAAGGG + Intergenic
1159722123 18:71904095-71904117 GTATCAGATAAATTAAAAAATGG + Intergenic
1164108040 19:22125926-22125948 GCATCAGCTGTGGTAATAAAAGG - Intergenic
926426220 2:12740780-12740802 GCATGAGCTCAGTTAAAGAAAGG - Exonic
928162665 2:28942536-28942558 TCATCAGATAAGAAAAGAAAAGG + Intronic
938114557 2:128594493-128594515 GCATCATCTCAGGTAAGACAAGG + Intergenic
938620324 2:133045504-133045526 GCAACATCTAGATTAAGAAATGG - Intronic
939241426 2:139565719-139565741 GCATCAGCAAAATCAGGAAAAGG + Intergenic
939919965 2:148098191-148098213 GCATCAGTCCAGTTAAGCAATGG + Intronic
940535644 2:154939604-154939626 TAATCAGATAAGTTTAGAAAAGG - Intergenic
940903623 2:159148828-159148850 ACATCAGCTTGGGTAAGAAAAGG - Intronic
942163632 2:173218778-173218800 GCATCAGTTTTGCTAAGAAATGG + Intronic
942758546 2:179370597-179370619 GCATTAGGTAATTTAAGAGAAGG - Intergenic
943460670 2:188168959-188168981 TCATCAGTTAAGGTAAGAACAGG + Intergenic
944136130 2:196401825-196401847 CCCTCAGATAAGTTAAGACATGG + Intronic
944586927 2:201180700-201180722 TCATCAGAGAAGTTTAGAAATGG + Intergenic
945407210 2:209463337-209463359 TCATGAGACAAGTTAAGAAATGG - Intronic
945472251 2:210240395-210240417 TAATCACCTAAGTTAAGATAAGG + Intergenic
948012544 2:234661519-234661541 GTATTTGCTAAGTGAAGAAATGG - Intergenic
1176949263 21:15024974-15024996 GCATCCAATAAATTAAGAAAAGG + Intronic
1177593838 21:23209983-23210005 GAATCAGCTAAATTAAGCATGGG + Intergenic
1178215126 21:30587756-30587778 GTATCAGCTATTTTAAAAAAGGG - Intergenic
1179072252 21:38082757-38082779 GCATGAGCTCAATTGAGAAAGGG + Intronic
1179338087 21:40476321-40476343 GGCTCAGGAAAGTTAAGAAATGG - Intronic
1182265606 22:29112638-29112660 GCCTCAGCTAAGATAAACAAGGG + Intronic
1182290970 22:29279297-29279319 GCATCATGTGAGTCAAGAAATGG + Intronic
950878820 3:16304802-16304824 GCAACAACAAAGATAAGAAAGGG - Exonic
950904471 3:16525265-16525287 GCCTCAGCTACATTAAGATATGG + Intergenic
955482915 3:59407512-59407534 GCATCAGGTCTGTAAAGAAAAGG + Intergenic
956298567 3:67742538-67742560 CCATTAGCTAAATTAAGAAAAGG - Intergenic
956362144 3:68460180-68460202 GCATTAGTGAAGTTAAAAAAGGG + Intronic
956868723 3:73395550-73395572 GCATCAGCTACCTTAATTAAAGG + Intronic
956988276 3:74730305-74730327 GCATCAGTGAAGTTCAGAAAAGG - Intergenic
960402261 3:117215642-117215664 TCATCAGCTAAGCTCAAAAAAGG + Intergenic
963460776 3:145612082-145612104 GCATCAGCTAAGGTATTCAAGGG - Intergenic
963878797 3:150504644-150504666 GCATCTGCTCAGTTCAGGAAAGG - Intergenic
967044447 3:185723856-185723878 GCATCATCCAAGTAAAGAAGAGG + Intronic
968192237 3:196677095-196677117 GGGTCAGCTTAGTTAAGAAAGGG + Intronic
970102557 4:12541654-12541676 GAACCTGCTAAGTAAAGAAAGGG - Intergenic
972841837 4:42939976-42939998 GCATTATCTCAATTAAGAAAAGG - Intronic
972869936 4:43285334-43285356 ACATCAATTAACTTAAGAAATGG - Intergenic
975594167 4:76031996-76032018 GCATTAGCTTAGTGAAGAAATGG + Intronic
976454544 4:85230361-85230383 GCATCAGAAAAGTTAAAATAAGG + Intergenic
977023328 4:91785127-91785149 GCATCAGATAGTTTACGAAAAGG + Intergenic
977951535 4:102976445-102976467 GCATTAGCTAATTTAATAAATGG + Intronic
978392746 4:108244302-108244324 GGATCAAATAAATTAAGAAATGG + Intergenic
979485958 4:121270647-121270669 GAAACTGCTAAATTAAGAAATGG - Intergenic
980321795 4:131289313-131289335 AAATCAGCTCAGTTAAAAAATGG - Intergenic
980629002 4:135409824-135409846 TCATCATCTAAATTTAGAAAAGG - Intergenic
980952886 4:139399062-139399084 ACATCAGCGAACTTAATAAATGG - Intronic
982058854 4:151582456-151582478 GCAACAACTTAGTGAAGAAATGG + Intronic
983350533 4:166582201-166582223 GCATCACCTAAGTTCTTAAAAGG + Intergenic
986427066 5:7644187-7644209 TCAACAGCAAAGTTAAGAAGTGG - Intronic
986815553 5:11405815-11405837 GCATCAGCCAACTTTAGACATGG + Intronic
989317927 5:40103907-40103929 GCATCAGCTGGGTTGAGAATGGG - Intergenic
992002524 5:72449797-72449819 GCATCTGCTGAGTGAGGAAAGGG + Intronic
994104270 5:95929013-95929035 GCATGAGCTAAGGCAAGAAGTGG - Intronic
994741772 5:103628247-103628269 CCATGACCTGAGTTAAGAAATGG + Intergenic
995196158 5:109371137-109371159 CCATCAGCTCCTTTAAGAAAAGG + Intronic
997111664 5:131081891-131081913 CCATCAGCTGAGTTAAGAATTGG + Intergenic
998297729 5:140987534-140987556 GAATCAGGAAAGTTAAGTAATGG - Intronic
998674691 5:144394343-144394365 ACATTAGCAAAGTAAAGAAAAGG + Intronic
999711259 5:154320585-154320607 GATTCAGCTGAGTTAAGGAAAGG + Intronic
999953408 5:156674326-156674348 GCAGCAACTAAGTTAAGAACAGG + Intronic
1000790330 5:165598988-165599010 GCATAAGCCAAGTTAAAATATGG - Intergenic
1000930031 5:167240451-167240473 GTATCAGTTAAGTTAAAAAAAGG + Intergenic
1003229628 6:4240411-4240433 GCATGAGCTAAGAGAGGAAAGGG + Intergenic
1005666209 6:28059081-28059103 TCATCATCTAAGTTTAGATAAGG + Intergenic
1006708509 6:36044456-36044478 ACATCAGCTGAGTAGAGAAAGGG - Intronic
1007194109 6:40045209-40045231 ACACCAGCAATGTTAAGAAAAGG + Intergenic
1007506105 6:42336690-42336712 GCATGAACTAAGTAAGGAAACGG + Intronic
1009879423 6:69547147-69547169 TGATCAACTAAGTTAAGACAAGG + Intergenic
1010189241 6:73177659-73177681 CCATCAGCAAAATTAAGAACTGG - Intronic
1010685544 6:78850791-78850813 TCATGAGCTAAGTTAGGAAGTGG + Intergenic
1011151683 6:84280909-84280931 TCATCAGCTGACTTAAGATAAGG - Intergenic
1011789694 6:90885291-90885313 GCATCAGCTAAGTGTGGAGAGGG + Intergenic
1012456854 6:99416752-99416774 GTATCATCTAAGTTAATAATAGG - Intronic
1022386600 7:29905205-29905227 GCATCAGCTGTGGTTAGAAAAGG - Intronic
1029953427 7:104611463-104611485 GCCTTAGCTAACTAAAGAAAGGG + Intronic
1032372846 7:131376715-131376737 TCATCAGCCATGTTTAGAAATGG + Intronic
1032691591 7:134293241-134293263 GTTCCAGCTAAGTAAAGAAAAGG + Exonic
1033674785 7:143529939-143529961 GCAGAAGCTAAGTTTAGAAAGGG + Intergenic
1033697052 7:143799500-143799522 GCAGAAGCTAAGTTTAGAAAGGG - Intergenic
1034575569 7:151994246-151994268 GCAAGAGATAAGTTAAGGAAGGG - Intronic
1036998034 8:13682638-13682660 GCATCAGATAACTCAAGAAATGG + Intergenic
1038545181 8:28420617-28420639 CCATCAGCCAATTTAGGAAAGGG - Intronic
1040578019 8:48671318-48671340 TCACCAGCTATGTTCAGAAAAGG + Intergenic
1041275761 8:56156143-56156165 GCAACATCAAAGTTAAAAAAGGG + Intergenic
1042448098 8:68912686-68912708 ACATGAGCTAAGTTAAGTAAAGG + Intergenic
1044453230 8:92362749-92362771 GCAAAAGCTAAGGTAAGAAATGG - Intergenic
1044821127 8:96156721-96156743 GCATCTGCTAAAATAAGAACAGG + Intronic
1044966594 8:97579831-97579853 GCATTAGCCAAGCTAATAAAAGG - Intergenic
1046504264 8:115116885-115116907 CCAACAGCAAAGTTAGGAAAAGG + Intergenic
1046594039 8:116239334-116239356 GCATTAGCTAGGTAAAGAAAGGG - Intergenic
1047827093 8:128588612-128588634 GCATCAAGTATGTTAAGCAAGGG - Intergenic
1048392747 8:133983752-133983774 GGCTCACCAAAGTTAAGAAATGG - Intergenic
1048437029 8:134427721-134427743 GCATCAAGTAAGTGAAGGAAGGG - Intergenic
1050920404 9:11194567-11194589 GCATCATTTGAGTTAAGCAATGG + Intergenic
1051987045 9:23102717-23102739 GCATATGCTCATTTAAGAAAAGG + Intergenic
1052272670 9:26642746-26642768 GTATCAGGCAAGTTAAAAAATGG - Intergenic
1052559617 9:30068462-30068484 ATATCATCTAAATTAAGAAACGG + Intergenic
1052871860 9:33515150-33515172 TCATGAGCAAGGTTAAGAAAAGG + Intergenic
1056675669 9:88675044-88675066 TCATCGGCTAATTTAAGTAAGGG + Intergenic
1059219550 9:112601100-112601122 GGGTCAGCTAAGATAAGAATTGG + Intronic
1059739156 9:117132819-117132841 GCATCTTCAAAGATAAGAAATGG - Intronic
1187243367 X:17532848-17532870 GGCTCAGATAAGTTAAGAAAAGG - Intronic
1189101367 X:38193416-38193438 GCATTAGGGAAGTTAAGACAGGG + Intronic
1189601115 X:42627515-42627537 GCATCAGTTAAGTCAAGAGCAGG + Intergenic
1190559089 X:51669810-51669832 GCACCGGCTAAATAAAGAAAAGG + Intergenic
1190565202 X:51723512-51723534 GCACCGGCTAAATAAAGAAAAGG - Intergenic
1193771568 X:85593590-85593612 GCATCAGCTGAGGTAGGATAGGG - Intergenic
1195143104 X:101983940-101983962 GCATCATTTAAATTAAGCAATGG - Intergenic
1195216539 X:102709828-102709850 GCATCAGTAACGTTATGAAAGGG + Intergenic
1201947795 Y:19530771-19530793 GCATCAGATAATTCAAGACATGG + Intergenic