ID: 1137339682

View in Genome Browser
Species Human (GRCh38)
Location 16:47589039-47589061
Sequence AGATGGGTATAGAACATCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137339682 Original CRISPR AGATGGGTATAGAACATCAT TGG Exonic
903659606 1:24969081-24969103 GCATGGCTATAGAACGTCATTGG - Intergenic
904242490 1:29157434-29157456 AGTTAGGGATTGAACATCATGGG - Intronic
906856470 1:49311464-49311486 AGCTGGGTATAGAACATATTTGG - Intronic
909173666 1:72326451-72326473 AGATCGGTGAAGAATATCATTGG + Intergenic
912217043 1:107626325-107626347 AGATGATTATAGAAGATAATAGG - Intronic
915962900 1:160282060-160282082 TGATGGGTACAGCACATCCTTGG + Exonic
917322615 1:173799236-173799258 AGATTTGGATAAAACATCATGGG + Intergenic
918941026 1:190997107-190997129 TCAAGGGTACAGAACATCATTGG + Intergenic
918962595 1:191299848-191299870 TGGTGGGTATAGAACCCCATGGG + Intergenic
923468869 1:234272666-234272688 AGATGCTTCTAGAACAGCATTGG + Intronic
924603050 1:245508161-245508183 TGAAGGGTCTAGAACATCCTTGG - Intronic
1067112611 10:43410870-43410892 AGATAGGTATTCAGCATCATAGG + Intergenic
1068707910 10:60097424-60097446 AGAAGGCTATAGAACATTAGTGG - Intronic
1069185398 10:65416481-65416503 AGAGGTTTATAGAAAATCATAGG - Intergenic
1073786742 10:106898272-106898294 AGATGTTTTTAGGACATCATTGG - Intronic
1078594876 11:12677040-12677062 ATATGGGTAAAGAAAATTATAGG + Intronic
1081354612 11:42096817-42096839 AAATGAGTATAGAATCTCATGGG - Intergenic
1084432244 11:69117576-69117598 AGTTGGGTATTGAACGTCACAGG + Intergenic
1087966716 11:104423842-104423864 AGATGAGCATAGAAAATCAGTGG - Intergenic
1093276458 12:17134426-17134448 AGATGGATATAGAAACACATAGG + Intergenic
1093481537 12:19608981-19609003 AGATGGAGATGGAACCTCATGGG - Intronic
1100257455 12:92898894-92898916 AGATGGCTAGAGAACATCAGAGG + Intronic
1105843267 13:24273723-24273745 ACATGTTTATAGAACATCAAAGG + Intronic
1109644947 13:65241756-65241778 AGATGGGTGCAGCACATCACAGG + Intergenic
1111305242 13:86403269-86403291 AGAGGGGAATTGAACAGCATGGG + Intergenic
1111417576 13:87968996-87969018 AGATGTGTAGAGAATGTCATAGG + Intergenic
1111718597 13:91912971-91912993 ATACTGGTATAAAACATCATTGG + Intronic
1111774135 13:92638066-92638088 ATATGGGAAGAGAACATCAGTGG + Intronic
1117593921 14:57306981-57307003 AGATGGCTACAAAGCATCATTGG - Intergenic
1117709134 14:58505735-58505757 AGATGGGAAAAGAACTTTATAGG - Intronic
1117833999 14:59783165-59783187 AGAGGGGTGTAGCACAACATAGG - Intronic
1118016941 14:61670261-61670283 TGATGGGAATAGAAGATAATGGG + Intergenic
1120641911 14:87024676-87024698 AGATGACTATAAAACATCCTGGG - Intergenic
1122440217 14:101726687-101726709 AGCTGGGTATAGGGCACCATGGG - Intergenic
1123739333 15:23220509-23220531 ATATTGGTATGGAACATCATTGG + Intergenic
1124290552 15:28449468-28449490 ATATTGGTATGGAACATCATTGG + Intergenic
1124292685 15:28468078-28468100 ATATTGGTATGGAACATCATTGG - Intergenic
1124967330 15:34445253-34445275 AAATGGGAAGAGAACATCAGTGG + Intergenic
1126464782 15:48951670-48951692 AGATGGAGAGAGAACATCCTAGG - Intronic
1126469990 15:48999095-48999117 AGGTGGGTAGAGAATTTCATGGG + Intronic
1127005514 15:54564870-54564892 TGATGGGTATAGAATAACAGTGG + Intronic
1129893396 15:79086839-79086861 AGAAGGGTATGGAACACCAAGGG + Intronic
1131087235 15:89587410-89587432 AGATGGGTTAAGATCACCATGGG + Intronic
1131955054 15:97726525-97726547 AGACAGGTATAAAACATCAGTGG - Intergenic
1132098609 15:99006871-99006893 AGATGGGGACAGAGAATCATGGG - Intronic
1133529409 16:6640828-6640850 AGATGGGGCTAGAACATGACAGG - Intronic
1137339682 16:47589039-47589061 AGATGGGTATAGAACATCATTGG + Exonic
1139135810 16:64203550-64203572 TCATGGGTATGGAACATCATAGG + Intergenic
1140733655 16:77878673-77878695 AAATGGGTATAGAAGCTCACAGG - Intronic
1141189985 16:81817597-81817619 AGATGTATGTAGAACATCAGAGG + Intronic
1141434030 16:83988837-83988859 ACATGGGTATATTACATAATGGG - Intronic
1203061865 16_KI270728v1_random:981562-981584 ATATTGGTATGGAACACCATTGG + Intergenic
1143024773 17:3935106-3935128 AGATGGGTCTAGAGCCGCATGGG - Intronic
1143321935 17:6074155-6074177 AAAAGGGTATAAAACATAATAGG - Intronic
1144108178 17:12005551-12005573 AAATGGATAAAGTACATCATTGG - Intergenic
1151541680 17:74767900-74767922 GGATGGGAACAGACCATCATGGG - Intronic
1153146292 18:2036613-2036635 GGATAGGTGTAGAACATCATAGG + Intergenic
1155845530 18:30701078-30701100 AGATGGCAAAAGAACATCCTAGG + Intergenic
1157001217 18:43527988-43528010 ATATAGGTATAGAATATCTTAGG + Intergenic
1158034099 18:53003602-53003624 AGATAGGTATAGAAAGTCTTTGG - Intronic
1162872508 19:13597408-13597430 AGATTGGTATATAAGATGATAGG + Intronic
1163333896 19:16659574-16659596 AGAAGGGTATTGAACGTCAGAGG - Intronic
1163716692 19:18877057-18877079 AGTTGGGTATAAAACAGGATGGG - Intronic
1167556728 19:50201171-50201193 AGATGGGGAAACAACATCCTGGG - Intronic
1168408997 19:56126970-56126992 AGATGGGTGAAGAACGTTATAGG - Intergenic
926218653 2:10920920-10920942 AGATGGGCATAGAACATGTGGGG + Intergenic
930763770 2:55063233-55063255 AGATGGGAATAGAAGATAGTGGG + Intronic
931249744 2:60519469-60519491 AGATGGGTGTGGAACATCGTAGG + Intronic
932066568 2:68569394-68569416 AGATTGGTATAGGACATCACAGG + Intronic
935229501 2:101083593-101083615 AGATAGGTAGATAACTTCATGGG - Intronic
935854678 2:107260968-107260990 AGATGGGTATATAGGTTCATGGG + Intergenic
937824710 2:126356119-126356141 AGATAGGTATAGAGTAACATGGG + Intergenic
939693728 2:145297732-145297754 AGTTGGTTATAGAAGATGATTGG - Intergenic
941880399 2:170475157-170475179 AGGTGGGACAAGAACATCATGGG - Intronic
945006493 2:205412917-205412939 AAATGGGTATATAACATCATAGG + Intronic
1169955341 20:11096699-11096721 ACATGGATATATAACATCGTGGG + Intergenic
1170883746 20:20319846-20319868 ACATGGGTATGGAGCATCAGTGG + Intronic
1171148031 20:22802843-22802865 AGGTGGGGAGAGAACATCACAGG + Intergenic
1173000903 20:39105045-39105067 AGCTGGGTTTATAACATCTTGGG + Intergenic
1173387763 20:42604740-42604762 AGAGAGATATAGAACATCACTGG - Intronic
1173405923 20:42764652-42764674 AGATGGGTAGATGACATCCTCGG - Intronic
1174909035 20:54586632-54586654 GGAAAGGTATAGGACATCATTGG + Intronic
1179490568 21:41738675-41738697 ACATGGCTATTGAACACCATGGG + Intergenic
1182957852 22:34443778-34443800 TGATGGGTAAAGAGCATCAAAGG - Intergenic
1183923706 22:41190022-41190044 AAATGGGAATACAACAGCATGGG - Intergenic
951378640 3:21955412-21955434 AGATGGATATGGAAGAACATTGG - Intronic
951490046 3:23260082-23260104 AGATGTGTATACAACATTGTTGG + Intronic
952189327 3:31005751-31005773 AGATGGGTCTCGAACTTCTTGGG + Intergenic
956171613 3:66437796-66437818 AGAGGGGAACACAACATCATGGG + Intronic
959833415 3:110891379-110891401 AGATGGCTAGAGAACACCAAAGG + Intronic
961702428 3:128756659-128756681 ACATGGATACAGAAAATCATGGG + Intronic
963221076 3:142812802-142812824 AGGTAGGTAGTGAACATCATAGG + Intergenic
968204058 3:196783043-196783065 AGATGAATATAGAAATTCATTGG - Intronic
968545568 4:1195998-1196020 ACATGAGAATAGAAGATCATGGG + Intronic
971291027 4:25339792-25339814 ACATGGGTATAGACACTCATTGG - Intronic
971471160 4:27028534-27028556 AGCAGGGTACAGAACATCAAGGG - Intergenic
971901431 4:32664516-32664538 AGTTGGGTATAAAATATAATGGG + Intergenic
972728049 4:41763687-41763709 AGAAGTGCATAGAACATGATGGG + Intergenic
973629795 4:52809860-52809882 CCATGGGTATAGAACAAGATGGG - Intergenic
977975542 4:103261214-103261236 AGGTGGGTGTGGAAAATCATGGG + Intergenic
977990487 4:103435128-103435150 AGATGAGTCTAGAGCATCTTGGG - Intergenic
978103403 4:104871828-104871850 AAATGGGGAAAGAACATCCTAGG - Intergenic
978504771 4:109444682-109444704 ACATGCTTATAGAAAATCATAGG + Intronic
981929693 4:150176153-150176175 AGATGGCTATGGAAAACCATGGG - Intronic
984284140 4:177707983-177708005 AGGTGGGAATAGAAGATCAGGGG + Intergenic
984983707 4:185307202-185307224 AGATGGGTAATGACCATCCTAGG + Intronic
989333148 5:40283391-40283413 AGATGGTTATAGATAAACATAGG + Intergenic
994422737 5:99542014-99542036 AGCTGGATATAGAAGCTCATGGG + Intergenic
994459636 5:100055493-100055515 AGCTGGATATAGAAGCTCATGGG - Intergenic
997569035 5:134911723-134911745 AGATGGATAGAGAACAGAATCGG - Intronic
1000318036 5:160111852-160111874 AGCTGGGTATAAAACAACAGTGG + Intronic
1007012500 6:38431136-38431158 AGATGGGTATTGAAAACCATGGG - Intronic
1011342523 6:86332848-86332870 ACATCTGTATAGAACCTCATCGG + Intergenic
1014309913 6:119787079-119787101 AGATTGGTTTACAACATCAGGGG + Intergenic
1014826755 6:126055745-126055767 AGATGGCTGTAGAACTTTATGGG - Intergenic
1016831487 6:148438091-148438113 TGATGGTTATAGAAGGTCATGGG + Intronic
1016858171 6:148692919-148692941 AGGAGGGTATAGAACCTCAGAGG - Intergenic
1018799552 6:167211287-167211309 GGATGGGAATAGAACATCCCTGG - Intergenic
1021954238 7:25807948-25807970 ACATGGGAAAAGAACCTCATTGG + Intergenic
1032240939 7:130158309-130158331 AGATGGGTTTAGAGGAGCATGGG - Intergenic
1037745540 8:21641253-21641275 AGATGGGAAAAGAAAACCATAGG - Intergenic
1038468054 8:27784693-27784715 GGATGGGTAGAGAGCATGATAGG + Intronic
1039106673 8:33997569-33997591 AGCTGGCTTTAGAACATCAAGGG + Intergenic
1042064602 8:64860039-64860061 AGATGACTTTAAAACATCATGGG + Intergenic
1051581773 9:18683920-18683942 AAATGGTGATAGAGCATCATTGG + Intronic
1052183751 9:25564253-25564275 AGATGGGTATAAAATATCAGGGG - Intergenic
1055158176 9:73090525-73090547 AGATGAATAGAGAACTTCATAGG + Intergenic
1055179591 9:73367954-73367976 AAATGGGTATAGAACAACAAAGG + Intergenic
1056032566 9:82568146-82568168 AGATGGGTTTAGAAAATTAAAGG - Intergenic
1059004054 9:110382664-110382686 AGATGAGTATAGAACCACCTTGG - Intronic
1188595241 X:31892332-31892354 TGATGGGCATAGAACTTCACCGG + Intronic
1189670664 X:43404904-43404926 AGAGGGGTATAGAATATATTGGG + Intergenic
1192451529 X:71248035-71248057 AGATGGGGGTAGAACATCCCGGG + Intronic
1196895692 X:120333538-120333560 AGCTGGGTATAGAAGATTACAGG - Intergenic
1197152050 X:123230753-123230775 AGATGGCTATGACACATCATTGG + Intronic
1197555841 X:127952032-127952054 TGATGGTTATACAACATTATGGG - Intergenic
1197912419 X:131497722-131497744 TGATGGGGATAGCACATCACTGG + Intergenic