ID: 1137341694

View in Genome Browser
Species Human (GRCh38)
Location 16:47613671-47613693
Sequence ATTTTGTGTAACCACCGTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137341694 Original CRISPR ATTTTGTGTAACCACCGTCA CGG Intronic
913541858 1:119828818-119828840 ATTTTGTTTGACCATCTTCAAGG - Intergenic
915032136 1:152889739-152889761 GTTTAGAGTAACCACCTTCATGG + Intergenic
1074946065 10:118281824-118281846 ATTTTGTTTCACAACCATCAAGG - Intergenic
1087810591 11:102605852-102605874 ATTTGGAGTAACCAGCATCATGG + Intronic
1088829452 11:113522867-113522889 ATTTCCTGTCACCACCCTCATGG - Intergenic
1089555840 11:119315652-119315674 CTTTTGTGTCACCACCGCCAGGG + Intronic
1091326894 11:134697893-134697915 CATCTGTGTAACCACCCTCAAGG + Intergenic
1097620244 12:61930207-61930229 ATTTTGTGTAAACAGATTCAAGG - Intronic
1100883509 12:99044350-99044372 GCTTTGTGTAACAACTGTCAGGG - Intronic
1101476933 12:105059897-105059919 ATTCTCTGTACCCACCATCAAGG + Intronic
1102180687 12:110910338-110910360 ATTTTGAATGACCACAGTCACGG - Intergenic
1109486279 13:63025036-63025058 ATTTTGTCTAACATCCATCAGGG + Intergenic
1111020994 13:82451828-82451850 ATCTTGTGTAACCACATCCATGG + Intergenic
1112038752 13:95524380-95524402 ATGTTGTGCAACCAACATCATGG + Intronic
1117700808 14:58411524-58411546 GTTTTGTGAAACCACTGACATGG + Intronic
1122043913 14:99010032-99010054 TTTATATGTAACCACAGTCATGG + Intergenic
1122044142 14:99011414-99011436 CTTATATGTAACCACAGTCACGG - Intergenic
1125084170 15:35711364-35711386 CTTTTATGTAATCACCTTCATGG - Intergenic
1126234989 15:46373327-46373349 ATTCTGTGTATCCAGCGCCAAGG - Intergenic
1129770766 15:78201944-78201966 ATTTTCTGTCACCACCTACAGGG - Intronic
1137341694 16:47613671-47613693 ATTTTGTGTAACCACCGTCACGG + Intronic
1145356615 17:22162416-22162438 ATTTTGTCTAACATCCGTCAGGG - Intergenic
1156080359 18:33326739-33326761 TTTTTCTGTAACCACCGAGAAGG - Intronic
1160790385 19:920256-920278 CTTTCGTCTAACCACCTTCACGG + Intronic
1165077775 19:33290358-33290380 CCCTTGTGTAACCAGCGTCAGGG + Intergenic
1166713784 19:44953700-44953722 ACTTTGTGTCATCACTGTCAGGG - Intronic
935716612 2:105944569-105944591 ATTTTCTGTAACAACCATCGCGG - Intergenic
939560457 2:143725588-143725610 ATTTTGTGGAACCACAGGGAAGG - Intronic
942541206 2:177017268-177017290 ATTTTGCCTAACCAGTGTCAGGG + Intergenic
942563322 2:177243358-177243380 ATTGTGTGTGCCCACCCTCATGG - Intronic
942986444 2:182148448-182148470 ATTTTCTGTGAGCACAGTCATGG + Intronic
1177754775 21:25333141-25333163 ATTTTGTGTAACAAAAGCCAGGG + Intergenic
951190761 3:19768277-19768299 ATTTTGAGTTTCCACCATCAGGG - Intergenic
957937162 3:86959129-86959151 ATTTTGTGTACCTACCTTGAGGG - Intronic
960081702 3:113548309-113548331 ATGTTGTGTATCCACCATTATGG + Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
964918405 3:161864930-161864952 ATTTTGAGTACCCACTTTCATGG + Intergenic
967454391 3:189666352-189666374 CTTTTGTGTAACCAATCTCAGGG - Intronic
981915809 4:150032084-150032106 AATTTGTGAAACCCCTGTCAGGG + Intergenic
995145076 5:108778488-108778510 ATTTAGTGTAAACAGCGTCCTGG + Intronic
1001256615 5:170188212-170188234 TATTTGTGTAACCACCAGCACGG - Intergenic
1003741408 6:8944961-8944983 TTTTTGTGTACCCACGGGCAAGG + Intergenic
1004571602 6:16851042-16851064 GTTTTGTGTACCCTCTGTCAAGG + Intergenic
1011408808 6:87044320-87044342 TTTTTGGGTATCCACAGTCATGG - Intergenic
1014696486 6:124627658-124627680 ATTTTGAGTTAACACCGTCAAGG - Intronic
1020848405 7:13316925-13316947 ATTTGGTGTAATCATGGTCAAGG - Intergenic
1025858787 7:65307309-65307331 ATTTTGCCTCTCCACCGTCAGGG - Intergenic
1034089228 7:148348656-148348678 TTTGTTTGTAAGCACCGTCAAGG + Intronic
1039517588 8:38146466-38146488 TTTTTGTCTAACCACCTTCTGGG - Intronic
1040775235 8:51035130-51035152 ATTTTGTTTCACCACCACCAAGG - Intergenic
1059817395 9:117932797-117932819 ATTGTCTGTAATCACTGTCAAGG + Intergenic
1188543274 X:31272796-31272818 ATTTTCTGTAACCTCCCTTATGG - Intronic
1198945183 X:142004142-142004164 ATATTGTGTACCCACTGACATGG + Intergenic
1200042817 X:153382068-153382090 ATTTTGTGTAATCATGGTCAAGG - Intergenic