ID: 1137343627

View in Genome Browser
Species Human (GRCh38)
Location 16:47634841-47634863
Sequence TGATAACAAAACTGCTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137343627_1137343632 12 Left 1137343627 16:47634841-47634863 CCTGATAAGCAGTTTTGTTATCA 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1137343632 16:47634876-47634898 TTACTGGAGAGTTTTAGGCAGGG 0: 1
1: 0
2: 6
3: 41
4: 342
1137343627_1137343629 -4 Left 1137343627 16:47634841-47634863 CCTGATAAGCAGTTTTGTTATCA 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1137343629 16:47634860-47634882 ATCATTTTACAGGAAGTTACTGG 0: 1
1: 0
2: 2
3: 22
4: 222
1137343627_1137343631 11 Left 1137343627 16:47634841-47634863 CCTGATAAGCAGTTTTGTTATCA 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1137343631 16:47634875-47634897 GTTACTGGAGAGTTTTAGGCAGG 0: 1
1: 0
2: 2
3: 107
4: 2189
1137343627_1137343630 7 Left 1137343627 16:47634841-47634863 CCTGATAAGCAGTTTTGTTATCA 0: 1
1: 0
2: 1
3: 27
4: 223
Right 1137343630 16:47634871-47634893 GGAAGTTACTGGAGAGTTTTAGG 0: 2
1: 0
2: 4
3: 45
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137343627 Original CRISPR TGATAACAAAACTGCTTATC AGG (reversed) Intronic
900734318 1:4286150-4286172 GGATGAAAAAACTGCCTATCAGG - Intergenic
900953276 1:5871501-5871523 GGGTAACCAAACTGCTGATCGGG + Intronic
903507047 1:23844105-23844127 TGATAATAATATTGCTTATATGG - Intergenic
905425136 1:37877416-37877438 TGATAAAATATCTGCTTATTGGG + Intronic
909737758 1:78986047-78986069 GGATCGAAAAACTGCTTATCAGG + Intronic
910092320 1:83479837-83479859 TGATACCAATGCTGCTGATCTGG + Intergenic
913415001 1:118595435-118595457 TGCTAACAAAAATCCTTAACAGG - Intergenic
914808146 1:151006786-151006808 TGATCACAAAGCTGCTGACCGGG - Intronic
916866200 1:168861920-168861942 TTATAACAAATTTGCTTATCTGG + Intergenic
917921967 1:179758129-179758151 TGCTAACAGAACTGCGTAGCTGG + Intronic
918467595 1:184837115-184837137 TCATAAAATAACTGCTAATCTGG - Intronic
918686549 1:187423221-187423243 AAATAACAAAACTGCTAATTTGG - Intergenic
918728559 1:187958761-187958783 TGTTAATAAAACTCCTAATCAGG - Intergenic
924097554 1:240569434-240569456 TGATTTCAAAACTTCTTATAAGG + Intronic
1065512101 10:26489661-26489683 TGATAACAATAATACTTATCTGG - Intronic
1067897491 10:50200041-50200063 GGATCAAAAAACTACTTATCAGG - Intronic
1067951484 10:50741996-50742018 GGATCAAAAAACTACTTATCAGG + Intronic
1068402484 10:56548481-56548503 TGATAGAAAGACTGCCTATCAGG - Intergenic
1070521657 10:77258996-77259018 TGATAACAAAAATCCTTTTTTGG - Intronic
1071149292 10:82614916-82614938 TGATATCAATGCTTCTTATCCGG + Intronic
1072711431 10:97718103-97718125 TGATTACAAATATGCTTTTCTGG + Exonic
1073999309 10:109353214-109353236 GGATCAAAAAACTGCCTATCAGG - Intergenic
1075699171 10:124457634-124457656 TAATAACAGAAATGCTTCTCAGG - Intergenic
1077955164 11:7010445-7010467 GGATAAAAAAACTACCTATCTGG + Intronic
1079370838 11:19850783-19850805 TGATAACAAAAATGATGATAAGG + Intronic
1079555572 11:21754393-21754415 AGATAAAAAAACTACCTATCAGG - Intergenic
1080358655 11:31485752-31485774 TGAGGACAAAAAAGCTTATCAGG + Intronic
1082230456 11:49759324-49759346 TGTTACCTAAACTGCTCATCGGG - Intergenic
1085246563 11:75106710-75106732 GGATCACAAAACTACCTATCAGG + Intronic
1086619595 11:88869638-88869660 TGTTACCTAAACTGCTCATCGGG + Intronic
1086926261 11:92643782-92643804 TGAGAACAAAAGTGCTTAGGTGG - Intronic
1088671735 11:112147544-112147566 TGATAACTAAGCTGCCTGTCAGG + Intronic
1090072462 11:123555705-123555727 TGATGAGAAAACTGAGTATCAGG - Intronic
1093484787 12:19641071-19641093 TGATAGCAAAACTCCTCAGCAGG + Intronic
1094800241 12:34024584-34024606 TGGTAACAAAACTGGTTAAGTGG - Intronic
1095455753 12:42384049-42384071 TAAAAACAAATCAGCTTATCAGG + Intronic
1095842902 12:46713987-46714009 AGATAAAAAAACTGCATATTGGG - Intergenic
1096945848 12:55409182-55409204 GGATCAAAAAACTACTTATCAGG - Intergenic
1098050719 12:66449667-66449689 TGATAGCAAAAATTATTATCTGG - Intronic
1099037773 12:77611223-77611245 AGAAAACAAAATTGCTTGTCAGG - Intergenic
1099507211 12:83493746-83493768 TGTTCACAAGACTGATTATCAGG - Intergenic
1099543141 12:83940593-83940615 TAATAACAAAACTGTTTATGTGG + Intergenic
1104509473 12:129363945-129363967 TGATAACAAACATGCCTAACTGG - Intronic
1104853782 12:131892424-131892446 GGATCAAAAAACTACTTATCGGG + Intergenic
1106178793 13:27353338-27353360 TCAGAACGAAACTGCTTATGCGG - Intergenic
1106278459 13:28239097-28239119 AGATATCCAAACTGCTTTTCTGG + Intronic
1106848159 13:33760018-33760040 TTGAAACAAAACTTCTTATCTGG - Intergenic
1107670045 13:42735736-42735758 GGATAACAAAACTTCTCGTCAGG - Intergenic
1109702029 13:66038665-66038687 TCATAACAAAAATGTGTATCAGG + Intergenic
1110334859 13:74315868-74315890 TGATAAAAAAACTACATATTGGG + Intergenic
1111278177 13:85980408-85980430 TGATTGAAAAACTGCCTATCAGG + Intergenic
1111415244 13:87932582-87932604 TGTCTACAAAACTGCTTGTCAGG - Intergenic
1112650793 13:101395195-101395217 TGATAGCAAAAATGCACATCCGG - Exonic
1113595288 13:111527404-111527426 TGAGAACAAGAATGCTTAACAGG + Intergenic
1115923297 14:38402586-38402608 TGATAACAGAAATCCTTCTCAGG - Intergenic
1116359905 14:43980668-43980690 GGATAAAAAAACTACCTATCTGG + Intergenic
1118031031 14:61818114-61818136 TGTTAACAAAACTTTTTATTAGG + Intergenic
1119630539 14:76228102-76228124 TGCTAACAAGACGGCTTGTCTGG + Intronic
1120631262 14:86893836-86893858 TGATAATCAAACTTCTAATCTGG - Intergenic
1122086453 14:99310210-99310232 GGATAAAAATAGTGCTTATCAGG - Intergenic
1123575092 15:21657699-21657721 GGATCAGAAAACTGCCTATCAGG - Intergenic
1123611708 15:22100188-22100210 GGATCAGAAAACTGCCTATCAGG - Intergenic
1126300924 15:47195390-47195412 TTAGAACAAAAATGATTATCTGG + Intronic
1126543192 15:49844256-49844278 TAATAACATAACTGCTTGGCTGG + Intergenic
1128290170 15:66472409-66472431 TGATAACAAAACTGTAAAGCAGG - Intronic
1128431861 15:67603893-67603915 TGGTAACAAAACTGCCTAATAGG + Intronic
1130003627 15:80070390-80070412 TGAAAACAATATTGCTTCTCAGG - Intronic
1130286206 15:82556993-82557015 TGGCAACAAAAATGCTTATAAGG + Intronic
1131710560 15:95050704-95050726 CGATAAAAAAACTACCTATCAGG - Intergenic
1202983960 15_KI270727v1_random:391943-391965 GGATCAGAAAACTGCCTATCAGG - Intergenic
1134159436 16:11874627-11874649 TGATAGTAAAACTGGTTATTGGG - Intronic
1137343627 16:47634841-47634863 TGATAACAAAACTGCTTATCAGG - Intronic
1139255109 16:65533643-65533665 GGATCAAAAAACTGCTTATCAGG - Intergenic
1140049841 16:71470722-71470744 TCATCACAAAAATGCTCATCTGG + Intronic
1141462779 16:84187564-84187586 TGATGCTGAAACTGCTTATCTGG + Intergenic
1142934298 17:3314813-3314835 GGATTAAAAAACTGCCTATCGGG - Intergenic
1143549040 17:7617724-7617746 TGATAACAGAAATAATTATCTGG + Intronic
1146552072 17:33789347-33789369 TGTTTATAAAAGTGCTTATCAGG - Intronic
1147483464 17:40789406-40789428 TGATGCCAGACCTGCTTATCAGG - Intergenic
1148288065 17:46414156-46414178 TGCTAACAGAAATGCTTATCTGG + Intergenic
1148310235 17:46631740-46631762 TGCTAACAGAAATGCTTATCTGG + Intronic
1150206082 17:63408988-63409010 TGATTACAAAACAGCATGTCAGG + Intronic
1150459938 17:65341878-65341900 GGATAAAACAACTGCCTATCAGG + Intergenic
1151052101 17:70989954-70989976 GGATAAAAAAACTGCATATTGGG - Intergenic
1153379700 18:4424324-4424346 TGTTAACACAGTTGCTTATCAGG - Intronic
1153860216 18:9195206-9195228 GGATCAAAAAACTGCCTATCAGG + Intronic
1156318668 18:35996643-35996665 TGATAATACAACTGCTATTCTGG - Intronic
1157778246 18:50414147-50414169 GGATCAAAAAACTACTTATCAGG + Intergenic
1158563283 18:58533227-58533249 TGATTTCAACACTGCCTATCTGG + Intronic
1158658548 18:59363358-59363380 TGATACTAATGCTGCTTATCTGG + Intergenic
1159326187 18:66922289-66922311 TTATAACAAATGTACTTATCTGG - Intergenic
1159648418 18:70947712-70947734 GGATAAAAAAACTGCTTATTGGG + Intergenic
1159861052 18:73649939-73649961 TGATAACAGCACTTCTTTTCAGG + Intergenic
1160604152 18:80036572-80036594 TGATACCATAACTGTTTATAGGG - Intronic
1160616500 18:80133992-80134014 TAAAAATAAAAATGCTTATCTGG - Intronic
1162671543 19:12261749-12261771 TATTATCAAAACTGGTTATCTGG + Intronic
1164336891 19:24332933-24332955 TCATCACAAAACTGTTTCTCAGG - Intergenic
1164837954 19:31370311-31370333 TGCTAATAGAACTCCTTATCTGG + Intergenic
1165829474 19:38723394-38723416 TGATAACAGAGCTGGTTAACAGG - Intronic
1166021766 19:40037701-40037723 AGAGAACAAAACTTCCTATCAGG + Intronic
1167743290 19:51337436-51337458 GGATCTCAAAACTGCTGATCAGG + Exonic
1168436470 19:56321726-56321748 TGAGGACATAACTGCTTTTCAGG + Intronic
924987495 2:285664-285686 TGATTTCAAAACTGTTTCTCTGG - Intronic
926455086 2:13057138-13057160 TGATCAGAAAACTGCTTCTCTGG - Intergenic
926994672 2:18721638-18721660 TGATATCAAAAATGCTTGTCAGG - Intergenic
927941159 2:27103687-27103709 TGATAACAAAACTGCAGGCCAGG + Intronic
928037558 2:27839203-27839225 GGCAAACAAAACTTCTTATCTGG - Intronic
929059101 2:37905113-37905135 TGAGATCCATACTGCTTATCTGG + Intergenic
930667039 2:54109431-54109453 GGATAAAAAAACTGCATATTGGG + Intronic
930984335 2:57566756-57566778 TGGAAACAGAACTGCTTATCTGG + Intergenic
931188406 2:59976010-59976032 TGAAAAAAAAAGTGCTTTTCTGG - Intergenic
933211650 2:79577294-79577316 TAATATTAAAAATGCTTATCTGG - Intronic
934532757 2:95105576-95105598 TGTTAACTAAACTGCTTACGTGG + Intronic
937235817 2:120431392-120431414 CGATCACCAAACTGCTTACCCGG - Intergenic
937807128 2:126159641-126159663 GGATCAAAAAACTACTTATCAGG + Intergenic
943128746 2:183830027-183830049 TGATAAAATGAATGCTTATCAGG + Intergenic
943149891 2:184098935-184098957 TATTACCAAAACTGCTTTTCTGG + Intergenic
943419169 2:187647440-187647462 TGATAAGAAAATTGCTTGTTGGG + Intergenic
946707791 2:222475784-222475806 TGATACCAAACCTACATATCTGG - Intronic
947460265 2:230298098-230298120 TTTTAACTCAACTGCTTATCTGG + Intronic
947470536 2:230397442-230397464 TTTTAACTCAACTGCTTATCTGG + Intronic
947737647 2:232464871-232464893 TGATAACAAATTTGCAAATCTGG - Intergenic
948539781 2:238682357-238682379 TAATAACAAAACTGTTTCTAAGG - Intergenic
1169653573 20:7896262-7896284 TGAAAACAACACTGGTTCTCAGG + Intronic
1171101334 20:22386034-22386056 TACTAACACAACTGGTTATCAGG - Intergenic
1175409499 20:58757060-58757082 TGGAAACAGAAGTGCTTATCTGG - Intergenic
1180391614 22:12288630-12288652 TGTTAACAAAACTGTCTATCTGG + Intergenic
1180408131 22:12576124-12576146 TGTTGACAAAACTGTCTATCTGG - Intergenic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
952560496 3:34587223-34587245 GGATAAAAAAACTACCTATCAGG - Intergenic
954651125 3:52163783-52163805 TGCTTAAAACACTGCTTATCTGG + Intergenic
955332778 3:58061342-58061364 TCTTAACAAAATTGCTTGTCAGG - Intronic
957659992 3:83137564-83137586 TGATAGGAAAATTGCTTATTTGG + Intergenic
958874612 3:99601813-99601835 TGACAACAGAACTGCTTCTAGGG - Intergenic
958994259 3:100884139-100884161 CTATAACAAAACTACTTATAAGG - Intronic
959244575 3:103848469-103848491 TAGTAATAAACCTGCTTATCTGG + Intergenic
959634715 3:108552668-108552690 TGAGAACAAAAATGTTTTTCAGG + Intronic
961023236 3:123528187-123528209 TTTTAACAACACTGCATATCTGG + Intronic
962313283 3:134340982-134341004 TGAGAACATAACTGCTTCTTTGG + Intergenic
963131109 3:141858693-141858715 AAATAACAAAATTGTTTATCAGG + Intergenic
963405601 3:144859760-144859782 TGACAACAAAACTCCTTTTATGG + Intergenic
963553090 3:146749819-146749841 GGATTAAAAAACTACTTATCAGG - Intergenic
966686130 3:182697920-182697942 TGATGAAAATACTGCTTACCTGG - Intergenic
967743843 3:193032653-193032675 TGATAACAATACTGCTAGTGTGG - Intergenic
968867857 4:3225254-3225276 TGTTCACCAAAATGCTTATCTGG + Intronic
970994776 4:22253016-22253038 TGATAATGAAACTGCTTTTGGGG - Intergenic
971157896 4:24102881-24102903 TGAAAACAACACTGCGAATCAGG + Intergenic
972121227 4:35706483-35706505 TATTCACAAAACTGCGTATCTGG - Intergenic
973016066 4:45139069-45139091 TGATAGTAAATCTGCTTATAAGG + Intergenic
974566754 4:63587890-63587912 TGAAAACAAAACTGGTTCTTTGG - Intergenic
976823232 4:89231307-89231329 TAAAAACAAAAGTGATTATCAGG - Intergenic
977786742 4:101043899-101043921 GGATAATAAAACTCCTTATCTGG - Intronic
978280590 4:107007633-107007655 TGACAACAGAACTGCTGATTTGG - Intronic
978317114 4:107450561-107450583 AGATTACAAAACTGTTTTTCAGG - Intergenic
979051525 4:115940203-115940225 TGCTAACAAAATTGTTTCTCAGG - Intergenic
979657524 4:123213108-123213130 TGAAAATAAAACTACTTATTTGG - Intronic
980606456 4:135097732-135097754 TGATAACAAAATTCAGTATCAGG - Intergenic
980733431 4:136850499-136850521 GGATACCAAAAATGTTTATCAGG + Intergenic
981228601 4:142326027-142326049 TGAAAACAAAACCTCTTATCTGG - Intronic
981677025 4:147354053-147354075 TGTGAACAGAACTGCTTACCGGG + Intergenic
983942156 4:173545976-173545998 AGAAAAGAAAAGTGCTTATCAGG + Intergenic
984873565 4:184348249-184348271 TGAAAATAAAGCTGCATATCAGG - Intergenic
985373529 4:189309901-189309923 TGAGAAGAACACTGCTTTTCTGG + Intergenic
986818674 5:11441277-11441299 TGATATAAAAACTGCTCATCAGG + Intronic
987652554 5:20761831-20761853 TGATTACAAAATTGCTAATCAGG - Intergenic
987730102 5:21758993-21759015 GGTTAAAAAAACTGCTTATCAGG + Intronic
988324447 5:29744136-29744158 TAATAGAAAAACTACTTATCAGG + Intergenic
988564171 5:32307797-32307819 TGGAAACAAAAGTGCTTAACTGG - Intronic
988743006 5:34099651-34099673 TGATTACAAAATTGCTAATCAGG + Intronic
988960848 5:36370067-36370089 GGATAAAAAAACTACTTGTCAGG - Intergenic
989715864 5:44462273-44462295 GGATCAAAAAACTACTTATCAGG - Intergenic
990876399 5:60491316-60491338 AGATAACAAAACACTTTATCTGG + Intronic
991969553 5:72125906-72125928 TGAGAACAAAACTCCTGACCTGG + Intronic
993299953 5:86196137-86196159 TCATAAAAAGACTGCTTATCAGG + Intergenic
994129223 5:96205435-96205457 GGATCAAAAAACTGCCTATCAGG - Intergenic
994318506 5:98361472-98361494 TGATAACCAAACTGAGCATCAGG + Intergenic
997023521 5:130030395-130030417 TGCTAAAAAAATTGTTTATCAGG + Intronic
997987599 5:138515521-138515543 TTTTAATAAATCTGCTTATCAGG + Intronic
998980988 5:147701963-147701985 TGATAACAGAACTGCCTTTGGGG + Intronic
999549874 5:152675053-152675075 TGATAACAAAACTACTGAGTTGG + Intergenic
999567385 5:152879855-152879877 GGATAAAAAAACTACCTATCTGG + Intergenic
1000805456 5:165785053-165785075 TGATAGTAAAACTGCTTTCCAGG - Intergenic
1000924894 5:167181202-167181224 TGACAACAAAAATGCTGACCTGG + Intergenic
1001206272 5:169766187-169766209 GGATCAAAAAACTGCCTATCAGG - Intronic
1002823347 6:749823-749845 AGAGAACAAAACTGCTTAATGGG + Intergenic
1003363157 6:5447863-5447885 TGATACCATATCTGCTTATGGGG - Intronic
1004136443 6:12971836-12971858 TAACAACAAAACTCCTTAGCAGG - Intronic
1005802561 6:29441701-29441723 GGATCAATAAACTGCTTATCAGG - Intronic
1009575999 6:65461273-65461295 TGCTAAAAATAGTGCTTATCAGG - Intronic
1009744050 6:67789316-67789338 TAATAACATAACTGTTTATTGGG - Intergenic
1011042845 6:83049992-83050014 TTATAGAAAAACTGCTAATCTGG + Intronic
1012796948 6:103774339-103774361 AGATAACAAATCTGCTTACCTGG + Intergenic
1013636186 6:112031743-112031765 TTTTAACAAACCTGCTTCTCTGG + Intergenic
1015063303 6:128995319-128995341 TCAAAACAAAACTGCCTATCAGG - Intronic
1015158422 6:130124666-130124688 TGATATCAAAAATACTTAACAGG + Intronic
1015510650 6:134035008-134035030 GCATAACAAAACTGCCTATGGGG - Intronic
1016203520 6:141443202-141443224 TGATAAGAAAACAGTTTAACAGG + Intergenic
1017576744 6:155813922-155813944 TGCTCACAAAACTGTCTATCAGG + Intergenic
1017611235 6:156188596-156188618 TGAGAACAAACCTTCCTATCTGG - Intergenic
1018619984 6:165720861-165720883 TGAGAACAAAACTCCATATATGG - Intronic
1020179756 7:5913131-5913153 TAATAACAAAACTGTTTAAAAGG - Intronic
1021265664 7:18518473-18518495 TGATAACAAATTTGATTATTTGG + Intronic
1024529758 7:50382225-50382247 TTATTCCAAAACTGCTGATCAGG + Intronic
1027309180 7:76936316-76936338 TGATACCAATGCTGCTGATCTGG + Intergenic
1029725433 7:102400514-102400536 AGAAAAAAAAACTGGTTATCTGG + Intronic
1029932541 7:104387907-104387929 GGATAGAAAAACTACTTATCAGG - Intronic
1032165664 7:129542785-129542807 AGATAAAAAAACTACTTTTCTGG - Intergenic
1032861342 7:135882801-135882823 GGGTAAAAAAACTGCCTATCAGG + Intergenic
1035411314 7:158644827-158644849 TGATAAGAATACTCCTTAACTGG - Intronic
1035983850 8:4403334-4403356 TTAGAACAAAACTCCTTATAAGG + Intronic
1036168665 8:6461663-6461685 AGGTAATAAAACTGCTTAACTGG - Intronic
1038727798 8:30096304-30096326 TGACAACAAAACTACCTAACAGG - Intronic
1038920021 8:32072666-32072688 AAATAACATAACTGCTTATATGG + Intronic
1039164288 8:34659597-34659619 TGAAAAGCAAACTGATTATCAGG - Intergenic
1039653039 8:39364499-39364521 GGATCGAAAAACTGCTTATCGGG + Intergenic
1041016310 8:53595545-53595567 TGATAACAATACTAGTTACCAGG - Intergenic
1045097759 8:98816214-98816236 TCATATCAAAACTGCTTTTTGGG + Intronic
1045932205 8:107640331-107640353 TCAGAACAAAACTGCTGAGCAGG - Intergenic
1046032220 8:108796716-108796738 TGATAATATTACTGCTTATTTGG + Intergenic
1046247655 8:111586224-111586246 TGATAACAAAGGTCCTTTTCGGG + Intergenic
1047541925 8:125776119-125776141 TGAGAACAAAACCCCTTATCAGG + Intergenic
1050415889 9:5417197-5417219 AGATAAAGAAACTGCTTACCAGG - Intronic
1050582548 9:7075719-7075741 TTACAGCAACACTGCTTATCAGG + Intronic
1050617648 9:7419287-7419309 GGATTAAAAAACTACTTATCAGG + Intergenic
1052157148 9:25206158-25206180 TGATAAAGAAACTGTTTATTGGG + Intergenic
1052611381 9:30779287-30779309 TCATCACTAAACTGCTTATGAGG - Intergenic
1053491563 9:38508666-38508688 TGATATCAAAATTGATTATTGGG + Intergenic
1054952907 9:70872934-70872956 TCAAAAGAAAAATGCTTATCTGG - Intronic
1055857685 9:80710385-80710407 TGAGAAAAAAACTGTTTATTTGG - Intergenic
1056615994 9:88166323-88166345 TGATAAGGAAACAGCTTTTCTGG + Intergenic
1059619644 9:115989143-115989165 AGATAACAAAAGAGCTTTTCAGG - Intergenic
1188295924 X:28448148-28448170 GGATAAAAAAACTACCTATCTGG + Intergenic
1190650180 X:52561905-52561927 TGATAACAAAACTTTTTATCTGG - Intergenic
1190961585 X:55255032-55255054 TGAAAACAACACTGCCCATCTGG + Intronic
1192131537 X:68556444-68556466 TGATAACACTACTGCTAGTCAGG + Intergenic
1192877364 X:75245817-75245839 GGATAAAAAAACTACCTATCAGG + Intergenic
1193392575 X:80946464-80946486 TGATTGAAAAACTACTTATCAGG - Intergenic
1193869955 X:86785002-86785024 TGATCAAAAAACTACATATCTGG + Intronic
1194176535 X:90655852-90655874 TGGTAACAAAACTACTTCTCAGG + Intergenic
1194312177 X:92324793-92324815 AAATAAAAAAACTGCTTATCGGG - Intronic
1194465226 X:94226472-94226494 TGATAACTAAACTGATAATATGG - Intergenic
1195605001 X:106795746-106795768 TAATAACAGAACTGCCAATCAGG + Exonic
1196490804 X:116263571-116263593 TGATAAGAAAATTGCTTATTTGG - Intergenic
1196913783 X:120511490-120511512 GGAAAACAAAACTGCTTATAAGG - Intergenic
1198302974 X:135349519-135349541 TGATCAAAAGACTCCTTATCAGG - Intronic
1199338463 X:146647175-146647197 GGATAAAAAAACTACCTATCAGG - Intergenic
1199474855 X:148233645-148233667 TGATAAGAAAACTGATTCCCTGG - Intergenic
1199618424 X:149677657-149677679 TAATAACATAACTGCTTGGCTGG - Intergenic
1199624218 X:149725592-149725614 TAATAACATAACTGCTTGGCTGG + Intergenic
1200523159 Y:4236764-4236786 TGGTAACAAAACTACTTCTCAGG + Intergenic
1200620448 Y:5438908-5438930 AAATAAAAAAACTGCTTATCGGG - Intronic
1200967824 Y:9116956-9116978 TAATAACATAACTGCTTGCCTGG - Intergenic