ID: 1137345131

View in Genome Browser
Species Human (GRCh38)
Location 16:47650522-47650544
Sequence TCTGTCAAACAGAATGAGGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137345131_1137345134 17 Left 1137345131 16:47650522-47650544 CCTACCTCATTCTGTTTGACAGA 0: 1
1: 0
2: 0
3: 20
4: 250
Right 1137345134 16:47650562-47650584 AAACAATATTGGAAAATGCATGG 0: 1
1: 0
2: 7
3: 57
4: 564
1137345131_1137345133 6 Left 1137345131 16:47650522-47650544 CCTACCTCATTCTGTTTGACAGA 0: 1
1: 0
2: 0
3: 20
4: 250
Right 1137345133 16:47650551-47650573 TGCAGTTCATTAAACAATATTGG 0: 1
1: 0
2: 0
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137345131 Original CRISPR TCTGTCAAACAGAATGAGGT AGG (reversed) Exonic
900016243 1:152239-152261 TCTTTATAAGAGAATGAGGTAGG - Intergenic
900046507 1:510830-510852 TCTTTATAAGAGAATGAGGTAGG - Intergenic
900068710 1:752547-752569 TCTTTATAAGAGAATGAGGTAGG - Intergenic
900434062 1:2619034-2619056 TTTGGCCAACAGAATGAGGTGGG + Intronic
901511438 1:9719940-9719962 GTAGTCAAACAGCATGAGGTTGG - Exonic
902208004 1:14883901-14883923 TCTGTAAAACAGACTGAGGCTGG - Intronic
902321412 1:15669832-15669854 TTTGTCTAACAGACTGATGTGGG + Intergenic
904879890 1:33688227-33688249 CCCATCAAACAGGATGAGGTAGG + Intronic
906771302 1:48487266-48487288 TCTGGCCATCAGAATAAGGTTGG + Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
911515876 1:98867347-98867369 ACTGGCAAACAGGAAGAGGTTGG - Intergenic
913591946 1:120337672-120337694 TCTGTAAAACAGAAAGAGACAGG + Intergenic
913651410 1:120917474-120917496 TCTGTAAAACAGAAAGAGACAGG - Intergenic
914169699 1:145211597-145211619 TCTGTAAAACAGAAAGAGACAGG + Intergenic
914524813 1:148455559-148455581 TCTGTAAAACAGAAAGAGACAGG + Intergenic
914598862 1:149180274-149180296 TCTGTAAAACAGAAAGAGACAGG - Intergenic
914641588 1:149611575-149611597 TCTGTAAAACAGAAAGAGACAGG - Intergenic
915103273 1:153515828-153515850 TCTGTCCAGAAGAATGAGGGAGG - Intergenic
915708034 1:157865214-157865236 TCTCTCAAACAAAATGATGGAGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916211834 1:162366014-162366036 TCTGTCACACAGAAAAAGCTGGG + Intronic
918134161 1:181656187-181656209 TCTGTAAAACAGTCTGAGGCAGG + Intronic
918916396 1:190645386-190645408 ACTGTAAAACAGACTCAGGTAGG - Intergenic
919762902 1:201109557-201109579 TCCATAAAACAGAATGAGGTGGG + Intronic
920266068 1:204723801-204723823 TTTGCCAAACAGAATGAGTGAGG + Intergenic
920753957 1:208709566-208709588 TCTGACAAATAGAATGAACTAGG - Intergenic
921508825 1:216007316-216007338 TCTGTAAAACAGAATGTGACTGG + Intronic
922011156 1:221589200-221589222 GCTGTAAAACATAATGAGGAAGG + Intergenic
923748687 1:236726813-236726835 TCTGCCAAACAGCATGGTGTAGG - Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924393915 1:243595803-243595825 ACTGTAAAACAGCATCAGGTGGG - Intronic
1064000689 10:11661590-11661612 CTTGTCAATCAGAATGAGGGAGG - Intergenic
1066466029 10:35651090-35651112 TCTGTCTAGCAGAACGAGCTGGG + Intergenic
1068081755 10:52327065-52327087 TGTGTCAAACACAATGCTGTAGG - Intergenic
1068121223 10:52783906-52783928 TATGACTAACAGAAAGAGGTGGG + Intergenic
1068995911 10:63203850-63203872 TCAATCAAAAAGAATGAGTTAGG - Intronic
1069250572 10:66261297-66261319 TCTGTAAAAGAAGATGAGGTAGG - Intronic
1071456629 10:85856164-85856186 ACTGTCATACAGATAGAGGTTGG + Exonic
1071567455 10:86679122-86679144 TCTGGCCAACTGAATGAGGGTGG - Intronic
1072432935 10:95389640-95389662 TCTGAAGAAGAGAATGAGGTGGG + Intronic
1072749166 10:97964454-97964476 TCTCTTAAAAAGATTGAGGTGGG + Intronic
1073394976 10:103210128-103210150 TGTGGCATCCAGAATGAGGTGGG - Intergenic
1073620006 10:105036831-105036853 TCTTTCAAATAAAATGAGGCTGG - Intronic
1074226238 10:111487262-111487284 TGTGTCAGACAGAATAGGGTAGG - Intergenic
1075329968 10:121566798-121566820 TCTGCCAAGCAGGATGGGGTCGG - Intronic
1076438148 10:130460295-130460317 TCTGACACACAGAATGGGGCCGG + Intergenic
1077629590 11:3801913-3801935 TCTGTCACACAGGCTGAGGCTGG - Intronic
1079946590 11:26750454-26750476 ACTGTCAAAAAGAATGAATTTGG + Intergenic
1080898462 11:36465596-36465618 TCTGCCAAACAGAATCAGAGGGG - Intergenic
1081142457 11:39518687-39518709 TTTGACAAACAGAATTAGATGGG - Intergenic
1083774147 11:64885007-64885029 TCTGCCAACAAGAATGAGCTTGG + Intronic
1086381898 11:86263174-86263196 GGTCTCAGACAGAATGAGGTTGG - Intronic
1086888491 11:92228580-92228602 TATGTCAAATAGAAAGAAGTAGG + Intergenic
1087335351 11:96837330-96837352 TCTATCAAAAAGAATGTGGGTGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1090881992 11:130841489-130841511 TCTGTGAAAAATACTGAGGTAGG - Intergenic
1091029838 11:132175760-132175782 TCAGTCTTAAAGAATGAGGTGGG - Intronic
1091953561 12:4616027-4616049 CCTGTTTAACAGAAGGAGGTTGG + Intronic
1092909149 12:13130673-13130695 TCTGTCAAATAAAATTATGTGGG - Intronic
1094121585 12:26980214-26980236 TCTGTTAAACATAATGGGGTAGG + Intronic
1097780246 12:63694506-63694528 TCTGTCAGACATAAAGATGTAGG + Intergenic
1099479693 12:83150436-83150458 TCTGCAAAACAGAATGAGGGGGG - Intergenic
1100571457 12:95847025-95847047 CCTGTCTAAAAGTATGAGGTGGG + Intergenic
1101176155 12:102153890-102153912 TCTGGCAAACAGTATGCAGTAGG + Exonic
1101929861 12:109005218-109005240 TCTGGCAAACAGACTGACTTGGG + Intronic
1102526003 12:113512685-113512707 CCTGACTAACAGAATGAGTTTGG + Intergenic
1104063598 12:125288168-125288190 TCTTTAAAACAGAAAGAGGCCGG - Intronic
1104105455 12:125654595-125654617 GCTGTCAAACAGGATGGAGTTGG - Exonic
1104228993 12:126865399-126865421 GCTGTCAAACAGGATGGAGTTGG - Intergenic
1104613863 12:130252851-130252873 TCTATCCAACTGAATGAGCTTGG + Intergenic
1105914885 13:24904889-24904911 TCCGTTAAATGGAATGAGGTAGG + Intronic
1106044757 13:26128592-26128614 TATGTCAAACAAAATGACATGGG + Intergenic
1108182920 13:47858816-47858838 TCTAACTAACAGAATGTGGTGGG - Intergenic
1110850508 13:80239508-80239530 TTTGGCAAACAGAAATAGGTTGG + Intergenic
1112361568 13:98723753-98723775 GCTGTCAAATAGATTGAGCTGGG - Intronic
1112536758 13:100265733-100265755 TCTGTCAGAAAGAAGGAGGGAGG - Intronic
1115004393 14:28464355-28464377 TCAGCCTAAAAGAATGAGGTAGG - Intergenic
1115164811 14:30436284-30436306 GCTGGTAAACAGAATCAGGTGGG + Intergenic
1115286266 14:31716209-31716231 CCTGTCAAACAGACTCAGGCAGG - Intronic
1118143411 14:63109952-63109974 TCTGGCAAACAAAATAAGGAAGG - Intergenic
1118364760 14:65085512-65085534 ACTGTCATACAGAATGAGAGAGG - Intronic
1120392580 14:83927556-83927578 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1121506109 14:94478830-94478852 TCAGGCAAAGAGAATGAGATAGG - Intronic
1121755210 14:96396577-96396599 TCTATCAAAATAAATGAGGTGGG + Intronic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1122540462 14:102495238-102495260 TCTGACAGCCAGAATCAGGTGGG + Intronic
1122678149 14:103434434-103434456 CCTGCCAAACTGAAAGAGGTAGG + Intronic
1124155887 15:27225023-27225045 TCAGAGCAACAGAATGAGGTGGG - Intronic
1124424915 15:29555768-29555790 TCTGTAAAAAGGAAAGAGGTAGG - Intronic
1126806469 15:52354553-52354575 GCTGTTAAAAAGAATGAAGTAGG + Intronic
1129950060 15:79578132-79578154 TGTGTCAAACAGATGGAGTTGGG - Intergenic
1130736889 15:86559832-86559854 TCTGTCTAGTAGAATGTGGTTGG + Intronic
1132220705 15:100103021-100103043 TCTGTCATCCAGAAAGAGGTGGG + Intronic
1132813190 16:1811891-1811913 CCTATCAAAAAGAATGAGGCCGG + Intronic
1134789421 16:16975521-16975543 ACTGTAAAACAGACTCAGGTAGG + Intergenic
1135072846 16:19367507-19367529 TCTGTCAGTCAGGATGAGCTAGG + Intergenic
1135653327 16:24226023-24226045 TCTTTCAAACATAATGATTTGGG + Intergenic
1136676853 16:31917781-31917803 TCTTTAAAACAGAATAAAGTAGG + Intergenic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141145039 16:81523409-81523431 CCTGTCACACAGAAGGACGTGGG + Intronic
1141876240 16:86826623-86826645 TCTTTCAAACAGATTGAGGGAGG + Intergenic
1142447416 16:90150219-90150241 TCTTTATAAGAGAATGAGGTAGG + Intergenic
1142460077 17:85113-85135 TCTTTATAAGAGAATGAGGTAGG - Intergenic
1146025824 17:29319954-29319976 ACTGTGAAAGAGAATGAGGGAGG + Intergenic
1146702986 17:34978354-34978376 ACTGTAAAACAGCATCAGGTAGG - Intronic
1147251146 17:39152990-39153012 ACTCTCAAACAGAATCAGATAGG + Intronic
1148427176 17:47608857-47608879 TAAGTCAAACAGAATGATGAAGG + Intronic
1149586383 17:57790404-57790426 TTTGTGAAACAGAAAGAGATTGG + Intergenic
1150842413 17:68621152-68621174 TTTCACAAACAGCATGAGGTTGG - Intergenic
1150872112 17:68923912-68923934 GTTGTCACACAGAATGAGATAGG + Intronic
1150885400 17:69080183-69080205 TATGTCAAACACAATGAGCTAGG + Intronic
1154234013 18:12585652-12585674 GCTATTAAACACAATGAGGTAGG + Intronic
1154953944 18:21237544-21237566 TCTGAAAACCAGAATGATGTTGG - Intergenic
1155583334 18:27337321-27337343 TCTTTCTCACAGAATAAGGTAGG + Intergenic
1156149343 18:34223923-34223945 TCTGTAAAACAGAATTTGATAGG - Intronic
1158750862 18:60258845-60258867 TCTGACAAAAATAATGAGGGAGG - Intergenic
1158992500 18:62884116-62884138 GCTGTCAAAAAGATTGAGTTAGG + Intronic
1159173694 18:64806851-64806873 TCTGTGAAACAGGGTGGGGTTGG - Intergenic
1160649792 19:217613-217635 TCTTTATAAGAGAATGAGGTAGG - Intergenic
1163640161 19:18457483-18457505 TCTGGAAAGCAGAATGAAGTTGG - Intronic
1165292693 19:34901346-34901368 TCAGTTACACAGAATGAGTTAGG - Intergenic
1166997626 19:46727341-46727363 TCTGTGAAACAGGATGAGCAGGG + Intronic
1167813699 19:51858554-51858576 ACTGTCAAACAAAATGGGGAAGG + Intronic
925699142 2:6615478-6615500 TGAGTCAAATAGATTGAGGTGGG + Intergenic
926336985 2:11871186-11871208 TCTATCAGTCAGAATAAGGTGGG - Intergenic
926583495 2:14659214-14659236 TCTGTGAAACAAAATCAAGTGGG - Intergenic
926834340 2:17000924-17000946 ACTGTGAAGTAGAATGAGGTAGG - Intergenic
927439922 2:23107008-23107030 TCTGCCAAACAGATTAAGGAAGG + Intergenic
929959540 2:46485928-46485950 TGTGGCAAACTGAATGAGGCTGG + Intergenic
930421277 2:51156322-51156344 TCTGTCAAACACACTGAATTGGG - Intergenic
931821939 2:65961119-65961141 TCTGCCAAAAGGAATGAGGCTGG + Intergenic
933565615 2:83946907-83946929 TCTGATAAACTGATTGAGGTAGG - Intergenic
935435363 2:103025564-103025586 TCTCACAAAGAGAATGAGCTAGG - Intergenic
935446294 2:103159895-103159917 TCTGTCACACTGAAAGAGATTGG - Intergenic
936342897 2:111653341-111653363 TCTGTCAAATGGAATGATGATGG - Intergenic
940211880 2:151263432-151263454 ATTTTAAAACAGAATGAGGTAGG + Intergenic
940669322 2:156648757-156648779 TCTTTCAAAAAAAATGAGGGGGG - Intergenic
941867644 2:170351306-170351328 TCTGGGAAAAAGAATGGGGTAGG + Intronic
941982683 2:171476652-171476674 TCTGTTAAACAGAAAAACGTGGG - Intronic
943515889 2:188885987-188886009 TTTGTCAACAAGAAGGAGGTAGG + Intergenic
943781364 2:191827805-191827827 TCTGCCAACAAGAATGAGCTTGG + Intergenic
945063841 2:205931741-205931763 TCTGCCACACAGAAAAAGGTGGG + Intergenic
947190617 2:227501088-227501110 TCTGTCAAAAAAAATTAGGCTGG - Intronic
1169518616 20:6346130-6346152 TCTGTCAATCAAAATAAGGATGG - Intergenic
1170842081 20:19932210-19932232 CCTGACAAAAAGAATGAGCTTGG + Intronic
1170878978 20:20277998-20278020 TCTAGCAAATAGAATGTGGTGGG - Intronic
1172266744 20:33622174-33622196 TTTGGAAAACAGCATGAGGTAGG + Intronic
1173115648 20:40240324-40240346 ACTATCACAAAGAATGAGGTAGG + Intergenic
1173237736 20:41263196-41263218 TCTTGCAAACAGAATGTTGTCGG - Intronic
1174995149 20:55558377-55558399 TCTCTCAAACTAAATGAGGTTGG + Intergenic
1175683011 20:61005107-61005129 TCTGTGAAACAGAAGGAGAGGGG + Intergenic
1177006872 21:15684269-15684291 TCTGTGTACCAGGATGAGGTAGG - Intergenic
1179776105 21:43663860-43663882 TATTTCAAAATGAATGAGGTAGG - Intronic
1183071369 22:35398938-35398960 GCTGTTAAACAGAATGAGGCCGG + Intergenic
949434568 3:4014473-4014495 TTTTTCAAACAGAATGTGGTTGG + Intronic
949760928 3:7469674-7469696 TCTGTGAACCAGGATGAGGAAGG + Intronic
950325556 3:12106075-12106097 TCTGCCAACAAGAATGAGCTTGG - Intronic
950405528 3:12801966-12801988 TCTGCCAAACAGATGGAGGAGGG - Intronic
950797254 3:15520313-15520335 TGTGAGAAACAGAAGGAGGTGGG - Intronic
951700890 3:25495646-25495668 GCAGTCAAAGAGCATGAGGTAGG + Intronic
951778468 3:26336778-26336800 TCTATCAACCAGAAAAAGGTTGG - Intergenic
952567577 3:34677942-34677964 AATGGCAAACAGAATGAGGCTGG - Intergenic
953688417 3:45096322-45096344 GCTGTTAAAAAGAATGAGGGAGG + Intronic
954261955 3:49445709-49445731 TCTATAAAATAGAATGAGGCTGG + Intergenic
956387770 3:68738893-68738915 TCTGACACACAGAATGATGCCGG + Intronic
956751763 3:72349074-72349096 TCTTTCCATGAGAATGAGGTTGG - Intergenic
960206637 3:114909058-114909080 ACTGTAAAACAGCATCAGGTAGG + Intronic
961673658 3:128551869-128551891 TCTGGGACACAGAAGGAGGTGGG - Intergenic
963973908 3:151459819-151459841 TCTGTGGAACAGCATGATGTTGG + Intergenic
964442295 3:156724755-156724777 GCCATTAAACAGAATGAGGTTGG - Intergenic
964870106 3:161304233-161304255 TTTGTCAAACAAAATCAGTTGGG - Intergenic
965419857 3:168444522-168444544 TCTGTCACACAGAAGGTGGCAGG - Intergenic
967364915 3:188675266-188675288 TCTCACAGACAGAATGAAGTGGG + Intronic
968368057 3:198202516-198202538 TCTTTATAAGAGAATGAGGTAGG + Intergenic
970049863 4:11901594-11901616 TCTGCCAAACAGTTTGAGCTGGG - Intergenic
970109524 4:12621990-12622012 TGTCTCAATCAGAATGAGGTTGG - Intergenic
970290542 4:14566531-14566553 TTTGTCCAATAGAATGTGGTAGG + Intergenic
971016371 4:22493444-22493466 TTTGTCTAACAAAAAGAGGTTGG - Intronic
971348980 4:25839496-25839518 GCTGTTGAAAAGAATGAGGTCGG + Intronic
971428462 4:26538986-26539008 TCTCTAAAACAGAATGAACTAGG - Intergenic
971787851 4:31128364-31128386 TTTGTCAAACTGTATTAGGTTGG + Intronic
974106107 4:57471882-57471904 TCTGACGAATAGACTGAGGTGGG - Intergenic
975129904 4:70822719-70822741 TTTGGCAAACAGCATGATGTTGG + Intronic
975662142 4:76698660-76698682 TCTTTAAAACAGAATGAGTTTGG - Intronic
976587845 4:86818974-86818996 TGGGTCTAACAGAATGAGGAAGG + Intergenic
977660018 4:99574243-99574265 TGTGTGAAACTGTATGAGGTTGG - Intronic
978773845 4:112486079-112486101 TTTGTTAAACAGAATGAGAGAGG + Intergenic
980104826 4:128577745-128577767 TTTGTAAAACACTATGAGGTCGG - Intergenic
981364673 4:143888628-143888650 TCTGTCCAAGACAATGAGATTGG - Intronic
982344663 4:154344343-154344365 TCTGTGAAGCACAATGAAGTGGG + Intronic
984384631 4:179040326-179040348 TCTGTGACACAGATTGAGGCTGG - Intergenic
984732909 4:183085103-183085125 CCTGTCATACAGGATTAGGTTGG - Intergenic
989553316 5:42761312-42761334 GCTGTTAAAAAGAATGAGGTAGG + Intronic
991684703 5:69170912-69170934 TCAATTAAAAAGAATGAGGTTGG - Intronic
992155450 5:73951063-73951085 CCTGTCTATCACAATGAGGTTGG - Intergenic
992455672 5:76913447-76913469 TCAGACAAACAGAATCAGGAAGG + Intronic
992844578 5:80733271-80733293 TCTGTGCAAGAGAATGAAGTTGG + Intronic
992860229 5:80901792-80901814 TCTGTCAAATACAATGAAATGGG - Intergenic
995461650 5:112410118-112410140 TCACTCAAACAAAAGGAGGTGGG + Intronic
995702534 5:114952646-114952668 TGTGTCAAACAGAATACTGTTGG + Intergenic
995916978 5:117259117-117259139 TCAGTCGAAAAAAATGAGGTAGG + Intergenic
998079017 5:139259400-139259422 TCTGCCAAGCACAAAGAGGTGGG - Intronic
998233230 5:140375036-140375058 TCTGTCAAACAGAATCTGTGAGG - Intronic
998816308 5:146017585-146017607 TCTGTGATACAGAAGGAGGGAGG - Intronic
1001116142 5:168941827-168941849 CCTGACAAACACCATGAGGTAGG - Intronic
1002727276 5:181307745-181307767 TCTTTATAAGAGAATGAGGTAGG + Intergenic
1004086078 6:12450817-12450839 TCTGTTAAAAAAAATGAAGTGGG + Intergenic
1007339505 6:41181604-41181626 TCAGTCAAACAGAGTGGGCTGGG - Intergenic
1007576233 6:42926786-42926808 TCTGACACACAGACTGAGGGAGG + Intergenic
1009031012 6:58058113-58058135 TTTCTCAAAGAGAAGGAGGTGGG + Intergenic
1009053045 6:58301390-58301412 TCTGTCACACAGAAAGACATGGG + Intergenic
1009206867 6:60812572-60812594 TTTCTCAAAGAGAAGGAGGTGGG + Intergenic
1009238065 6:61149170-61149192 TCTGTCACACAGAAAGACATGGG - Intergenic
1012406652 6:98908371-98908393 TCTATGAAACGGAAGGAGGTGGG - Intronic
1014713296 6:124834527-124834549 TCTATTAAAAACAATGAGGTAGG + Intergenic
1016173011 6:141042202-141042224 TCTGACAACTAGAATTAGGTAGG - Intergenic
1018071540 6:160168404-160168426 TGTGACAAACAGGATGAGGTGGG - Intergenic
1021918553 7:25460207-25460229 TCTGTCTCACAGAATGTTGTGGG + Intergenic
1022040440 7:26576371-26576393 TCAGTACAACATAATGAGGTAGG + Intergenic
1022654624 7:32307419-32307441 TCTGGCTAACAGAATGTGGGAGG - Intergenic
1023380811 7:39606447-39606469 ACTGTCAAAGAGAATGAGATTGG - Intronic
1024453914 7:49580878-49580900 TCTGTCAGAAAGAATGTGCTAGG - Intergenic
1024676948 7:51645783-51645805 TCTGTCACACAGGAGGAGGCAGG + Intergenic
1027454272 7:78368302-78368324 ACTATTAAACAGAATGTGGTTGG + Intronic
1027738544 7:81968421-81968443 TCTGTTAAAGTGAATTAGGTAGG - Intronic
1028380980 7:90198122-90198144 TGTGTCAAACAAAATTAGGATGG - Intronic
1031734830 7:125345794-125345816 TATGCCAAACAGAGTGGGGTTGG - Intergenic
1031819654 7:126484200-126484222 TCTGTCATACAAAATGATGGAGG + Intronic
1032237390 7:130137257-130137279 TCTGTCAAATAGGAGGAGGTTGG + Intergenic
1032654420 7:133912144-133912166 TCTGTCTAATACAATGGGGTGGG - Intronic
1034841045 7:154397003-154397025 TCTATGAAACAGAATGAAATGGG + Intronic
1036422541 8:8611780-8611802 TCTGTCAGCCAGACAGAGGTAGG - Intergenic
1042301964 8:67293567-67293589 TCTATAAAAAAGAATGAGGAAGG + Intronic
1044073354 8:87789300-87789322 GCTGTTAAACAGAATGAAGAAGG - Intergenic
1047037273 8:120953618-120953640 TCTGTCAAATAGCATTAAGTGGG - Intergenic
1047570289 8:126090625-126090647 TTTGGCCAATAGAATGAGGTAGG + Intergenic
1047919102 8:129614937-129614959 TTTGTAAAACAGCATGATGTTGG + Intergenic
1048105576 8:131404707-131404729 TCTGTGAAACACAAAGTGGTGGG + Intergenic
1050354426 9:4769552-4769574 TCTGTCGAACAGGAAGTGGTAGG - Intergenic
1051021294 9:12546863-12546885 TTTGGCCAACAGAATGTGGTTGG - Intergenic
1052675353 9:31615343-31615365 TCTTTTAAACATAATGTGGTAGG - Intergenic
1052760752 9:32588609-32588631 TCTGGCAAATAGAATGTGGATGG - Intergenic
1053152502 9:35751873-35751895 TTTGTAAAACAGCTTGAGGTTGG + Intronic
1054736547 9:68757509-68757531 TCTTTCAGAGAGAAAGAGGTAGG - Intronic
1055925061 9:81501505-81501527 TCCCTCAAACCTAATGAGGTAGG + Intergenic
1057292767 9:93818063-93818085 TCTGTCAAAAGGAAGGAGGGAGG + Intergenic
1057889934 9:98862233-98862255 TCTTTCAAACAGGATGCGGGTGG + Intergenic
1058312944 9:103528899-103528921 TCTCTTAAAAAAAATGAGGTTGG + Intergenic
1058753768 9:108065108-108065130 TCTCTAAATCAGAATGGGGTTGG - Intergenic
1060325728 9:122613038-122613060 TCTGTCTCGCAGAATGAGGTTGG - Intergenic
1061528938 9:131194703-131194725 TCTGTCAAAATGACTGAGTTAGG + Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062338010 9:136080987-136081009 TCTGTTAATCAGAATGTGCTTGG - Intronic
1062619317 9:137412249-137412271 TGTGTCAGACAATATGAGGTGGG - Intronic
1062752398 9:138265221-138265243 TCTTTATAAGAGAATGAGGTAGG + Intergenic
1203574911 Un_KI270745v1:3-25 TCTTTATAAGAGAATGAGGTAGG + Intergenic
1188560197 X:31459709-31459731 TCTCTTAACCAGAATGAGGCTGG - Intronic
1189064207 X:37789008-37789030 TCTGCCAACAAGAATGAGCTTGG - Intronic
1193133656 X:77945997-77946019 TTTGTCAAAAAAGATGAGGTAGG + Intronic
1194449713 X:94029414-94029436 TCTGTCATACAGATTCAGGCTGG - Intergenic
1194668604 X:96703610-96703632 GCTGTCAAACTGAATGTGTTGGG + Intronic
1195654262 X:107320117-107320139 TCTTTCCAACAGCAAGAGGTTGG + Intergenic
1196769269 X:119277316-119277338 TCTGTCATCCAGAGTGAGGCAGG - Intergenic
1197371563 X:125632922-125632944 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1197516462 X:127436463-127436485 ACTGTTAAACAGAAAGAGGAAGG + Intergenic
1198881327 X:141284368-141284390 TCTCTCAAACACTATAAGGTTGG + Intergenic
1198922234 X:141742719-141742741 TCTTTCAATCTGAATGAGGCAGG - Intergenic
1199260046 X:145761885-145761907 TGTGTCAACCAGAATGAGATGGG + Intergenic
1201628127 Y:16038086-16038108 TCTGTCAAACGGACTGGGGTGGG + Intergenic