ID: 1137347224

View in Genome Browser
Species Human (GRCh38)
Location 16:47675383-47675405
Sequence GGTCTTCTCCCCATGACATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137347224 Original CRISPR GGTCTTCTCCCCATGACATT TGG Intronic
900538310 1:3190056-3190078 GCTCTTCTCTCCCTGACATGGGG + Intronic
903268052 1:22170299-22170321 GGTCTGCTCCCCACAAGATTGGG - Intergenic
907284490 1:53371101-53371123 GGTCTCCTCCCTAAGACAGTGGG - Intergenic
909515322 1:76501009-76501031 GGTCTTCCCCCCACTACCTTAGG - Intronic
911490870 1:98563973-98563995 TGGGTTCTCCCCATGACATATGG - Intergenic
913513765 1:119585408-119585430 GGTCTTTTGCCAGTGACATTGGG + Intergenic
917845637 1:179018035-179018057 GGTGTTCTGCCCTTGACATCTGG + Intergenic
920454222 1:206086026-206086048 GTCCTTTTCCCCATGATATTTGG + Intronic
921985416 1:221306943-221306965 CATCTTTTCCCCATGACCTTGGG - Intergenic
924499101 1:244619590-244619612 ATTCTTGTCCCCATGGCATTCGG - Intronic
1066462570 10:35624636-35624658 GGCCTTCTTCCCAAGGCATTTGG - Intergenic
1066696569 10:38084380-38084402 GCTATTCTCCCCTTGAGATTTGG - Intergenic
1069614517 10:69798532-69798554 TTTCTTCTCCCCAGGACATATGG - Intergenic
1070579088 10:77705210-77705232 GGTGTTGTCACCATGACTTTGGG + Intergenic
1071231041 10:83586148-83586170 GATCTTCTCCCCTTGAGTTTGGG - Intergenic
1073326879 10:102648280-102648302 GGTCTTCTTTCCATGTCATGGGG - Intronic
1074272168 10:111964957-111964979 GGTCCCCCCCCCATGACATGTGG + Intergenic
1074699533 10:116080964-116080986 TGCCTTCTCCCCATGGAATTAGG - Intronic
1074958658 10:118418637-118418659 GGGCTTCTTGCCTTGACATTTGG - Intergenic
1076433892 10:130426468-130426490 GGCCATCTCCCCATGCCATGTGG + Intergenic
1078187929 11:9068213-9068235 GGTCTTCTGTCCATGGCTTTGGG + Intronic
1078832677 11:14992271-14992293 TGTCTTCTCCCCTCGATATTAGG - Intronic
1080132988 11:28818246-28818268 GGTCTTATCCCAATGACTTCAGG + Intergenic
1092673665 12:10891342-10891364 TGTCTTCTCCAGATAACATTAGG - Intronic
1093523448 12:20077013-20077035 GGTCCCCTCCCCATGTCCTTGGG - Intergenic
1099673207 12:85721513-85721535 TGTCTTTTACCCATGACATCTGG + Intergenic
1103514462 12:121498224-121498246 GGTCTTCTCCCCCAGCCATTTGG - Intronic
1104410863 12:128556591-128556613 TGTCTTCTCCCCTTGAAACTGGG + Intronic
1104511411 12:129382807-129382829 GGACTTCTCCCCCTGTCTTTGGG - Intronic
1107650395 13:42539269-42539291 AATCTTCTACCCATTACATTAGG + Intergenic
1108671772 13:52697398-52697420 TGTACTCTCCCCAAGACATTTGG - Intronic
1108721310 13:53135692-53135714 TGTCTTCTCCCCTTGAATTTGGG + Intergenic
1108859762 13:54841847-54841869 AGTCTGCTCCACAAGACATTTGG - Intergenic
1115712565 14:36067151-36067173 GGTCTTCTCCCCATGAATCCAGG + Intergenic
1116354695 14:43913972-43913994 GATTCTCTCCCCATGACATGTGG - Intergenic
1118733889 14:68688849-68688871 GGTCCTGTCCCCAGGACAGTTGG - Intronic
1122166329 14:99827120-99827142 TGTCTTCTCCCCATGTCTTCAGG - Intronic
1126050130 15:44677711-44677733 GGTCTTATCACCATGACAAGAGG - Intronic
1130824928 15:87533974-87533996 TGGCTTCCTCCCATGACATTTGG + Intergenic
1131886362 15:96918292-96918314 GGTATTATCCACATTACATTTGG - Intergenic
1132939353 16:2499261-2499283 GGTCTTCGCCCCAAGACAGCTGG + Intronic
1133817167 16:9206791-9206813 GGGCCTCTCCACAGGACATTTGG - Intergenic
1136003139 16:27311468-27311490 TGTCGTCTCCCGATGACATGGGG + Intergenic
1137347224 16:47675383-47675405 GGTCTTCTCCCCATGACATTTGG + Intronic
1138459175 16:57137963-57137985 GGTCTTCTCCCCCTGCCCTAAGG + Intronic
1140849517 16:78921999-78922021 TGTCCTCTACCCATGACATCAGG + Intronic
1148172367 17:45533148-45533170 GCTCTTCTCCAGCTGACATTAGG + Intergenic
1148276900 17:46312304-46312326 GCTCTTCTCCAGCTGACATTAGG - Intronic
1148299016 17:46529888-46529910 GCTCTTCTCCAGCTGACATTAGG - Intronic
1148363556 17:47034415-47034437 GCTCTTCTCCAGCTGACATTAGG - Intronic
1150403573 17:64880064-64880086 GCTCTTCTCCAGCTGACATTAGG + Intronic
1157322186 18:46643032-46643054 GGCCTTCTCCCCAAGGCATCAGG + Intronic
1164832684 19:31334727-31334749 GGTTTTCTCACCATAACATATGG + Intronic
1165318030 19:35068496-35068518 GGTGTTCTACCCATGGCATGTGG + Intergenic
1165634549 19:37329730-37329752 GGTTTTTTCCCCCTCACATTGGG + Intronic
1167506871 19:49875617-49875639 CCTCTTCTCCGCATGTCATTAGG - Intronic
925344054 2:3157425-3157447 TGTTTTCTCTTCATGACATTAGG + Intergenic
928580192 2:32699489-32699511 GGTGTTCTCTCCATTGCATTTGG + Intronic
928649892 2:33392922-33392944 GGTCTTCACCCCATGAGCTGAGG + Intronic
929338794 2:40786487-40786509 TGTTTTCTCTCCATAACATTTGG + Intergenic
929575059 2:43046330-43046352 GGCCCTCTCCCCATAACCTTGGG - Intergenic
931723275 2:65083090-65083112 GATCTTCTCCCCAGCTCATTTGG + Intronic
932752064 2:74377574-74377596 GGACTTCTCCTCATAACATGGGG - Intronic
936887412 2:117329430-117329452 GATTTTCACCCCATGACAATTGG + Intergenic
939958273 2:148545051-148545073 GGGCTTCTGCCTATGACATTAGG + Intergenic
942210934 2:173669337-173669359 TGTCTTCTCCCCTTGAAACTAGG - Intergenic
942460648 2:176165749-176165771 CATCTTCACCCCAAGACATTTGG + Intronic
945967080 2:216199785-216199807 GGATTTATCCCCATGGCATTGGG + Intronic
948575212 2:238945522-238945544 TGTCTAGGCCCCATGACATTTGG - Intergenic
948909017 2:240993766-240993788 GGTCTTTTCCCCTTGACTCTGGG - Intergenic
1169200962 20:3710000-3710022 AGTGTACACCCCATGACATTAGG - Intergenic
1170270622 20:14523492-14523514 AGTCTCCTCCCCAGGAGATTGGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1172063889 20:32206504-32206526 CGTTTTCTCCCCATGAAAATGGG - Intronic
1175670315 20:60896925-60896947 GCTTTTGTCCCCATCACATTCGG - Intergenic
1176977872 21:15344464-15344486 TGTCGTCTACCCCTGACATTTGG + Intergenic
1177398293 21:20566411-20566433 TGTCTCCTCCCAATTACATTTGG + Intergenic
1178221684 21:30668060-30668082 CGGCTTTTCCCCATGACATGTGG - Intergenic
1179836646 21:44039024-44039046 GCTCTTCTCCCCATAACACCTGG + Intronic
1184065846 22:42120117-42120139 GGTCTTCTCACCTGGGCATTTGG - Intergenic
1184717070 22:46288401-46288423 GGTCTCCTCCCCATGTCCTCAGG + Exonic
1185041560 22:48506984-48507006 GGGGTTCTCCCCATGCCACTCGG - Intronic
1185103116 22:48852250-48852272 GGTCTTCTCCCTCTGTCCTTGGG + Intergenic
951317428 3:21204166-21204188 CGGGTTCTCCCCATGACATATGG - Intergenic
953687250 3:45087600-45087622 GGTCTTTTCCCCATGAGAAGTGG - Intronic
954870757 3:53765871-53765893 GGACTTATCTCCATCACATTTGG + Intronic
960433546 3:117598956-117598978 AGTCTTCTCACCAGGACTTTAGG + Intergenic
961375712 3:126464492-126464514 GGTCTTCTACCCCTGACAGCTGG + Intronic
962278501 3:134033074-134033096 GGTTTTCTCCCCAGCACAATGGG + Intronic
962815813 3:138998108-138998130 GGTGTTTTCCCCCTGAGATTGGG - Intergenic
962917187 3:139915099-139915121 GGTGCTCTACCCATGCCATTTGG - Intergenic
969858897 4:10020759-10020781 GGTCTGCACCCCATCAGATTGGG + Intronic
970435606 4:16031707-16031729 TGTTTTGTCTCCATGACATTGGG - Intronic
971042605 4:22770967-22770989 AGTCACCTCCCCATGACATGTGG - Intergenic
971504472 4:27351208-27351230 GTTCTTCTCTCCAGGAGATTTGG - Intergenic
972473490 4:39429496-39429518 GGTTGTCTCTCAATGACATTAGG + Intronic
978921150 4:114184046-114184068 GAGTTCCTCCCCATGACATTTGG - Intergenic
979276715 4:118822889-118822911 GGTCTTCTCCCCTTTACTTCTGG + Intronic
979437370 4:120709815-120709837 GGTTTTCTGCTTATGACATTTGG - Intronic
983417454 4:167476857-167476879 GGTCTTCTCCCTATGACTGGAGG - Intergenic
984521629 4:180809093-180809115 AGTCCTGTCCTCATGACATTTGG - Intergenic
986785007 5:11106051-11106073 CATCTGCTCCTCATGACATTTGG - Intronic
986867771 5:12009509-12009531 AGGGGTCTCCCCATGACATTTGG + Intergenic
993551971 5:89284357-89284379 GGTCTTATCCACATGACCTTTGG + Intergenic
995433384 5:112107813-112107835 GGGCTTCTACAAATGACATTTGG - Intergenic
996795338 5:127340547-127340569 AGTCTTCTCCCCATGTCGATAGG - Exonic
1000145345 5:158448286-158448308 GGTCTTCTCTCCAGGTGATTTGG - Intergenic
1001018100 5:168159762-168159784 GGTTTTCTCCACATCACATGAGG - Intronic
1003487656 6:6593480-6593502 TATATTCTCCCTATGACATTAGG - Intronic
1006239772 6:32667097-32667119 GCTCTTCTCCCCAGGACTTAAGG - Intronic
1009222955 6:61000538-61000560 GTTCTTCTTCCCTTGATATTAGG - Intergenic
1011233085 6:85185876-85185898 GCTCTAGTCCCCATGAGATTGGG + Intergenic
1013931553 6:115540647-115540669 ATTCTTCTCCCACTGACATTGGG - Intergenic
1015208194 6:130666050-130666072 GCTCTTCTTCCCAGGACACTGGG + Intergenic
1017084806 6:150704259-150704281 GGTCTTCTTCCCATGGAGTTTGG + Intronic
1021141490 7:17030898-17030920 GTTCTTCTCCACATGACTGTTGG + Intergenic
1022297122 7:29066685-29066707 CGTCTTCTCTCCATGTCATCTGG - Intronic
1022622843 7:32002406-32002428 AGTCTCCTCCACATGACCTTGGG + Intronic
1022767443 7:33429981-33430003 GGTCTTTTCCCCATGAAGTCAGG + Intronic
1029301921 7:99587776-99587798 CGTCTCCTCTCCATTACATTAGG + Intronic
1031243214 7:119271667-119271689 GTTCTTCTCCCCATGACCTGGGG + Intergenic
1035461265 7:159040597-159040619 GGTCTTTTTCTCATGATATTAGG - Intronic
1036818334 8:11918608-11918630 GGTGTACACCCCATGACGTTAGG - Intergenic
1037614963 8:20510725-20510747 GATCTTCTCCCCTTGAGAGTGGG + Intergenic
1040466934 8:47704348-47704370 GGTCTTCTCCACTTGGAATTAGG - Intronic
1042819722 8:72916770-72916792 GGTATTCTTCCCATGAAGTTTGG + Intronic
1043222677 8:77686943-77686965 GGTCTCTTCCACATGATATTAGG + Intergenic
1049517232 8:143066920-143066942 GGCCTTTTCCCCATGATATTTGG - Intergenic
1055478338 9:76685622-76685644 TGTCTTCTCCCCATGTCTTCTGG - Intronic
1062274625 9:135724939-135724961 GGTCTTCCCCCCATGAGAGGGGG + Intronic
1062526576 9:136980294-136980316 GATCCTCTCCCCATCAGATTAGG - Intronic
1186251978 X:7678098-7678120 GGTCCTCTCTCCATGGCTTTGGG - Intergenic
1188172885 X:26949922-26949944 GGTCTTATCCCCATCACATATGG - Intergenic
1191957539 X:66661512-66661534 GGTCCCCACCCCATGACATGTGG - Intergenic
1192208334 X:69110547-69110569 GGCCCTCTCACCAGGACATTGGG - Intergenic
1198495980 X:137193947-137193969 GGACCTCTCCCCATAGCATTTGG + Intergenic