ID: 1137348584

View in Genome Browser
Species Human (GRCh38)
Location 16:47689063-47689085
Sequence TATGAACTTCAGATCCGTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137348581_1137348584 -10 Left 1137348581 16:47689050-47689072 CCATGCCATGGAGTATGAACTTC 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1137348584 16:47689063-47689085 TATGAACTTCAGATCCGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1137348577_1137348584 16 Left 1137348577 16:47689024-47689046 CCCCTGTTTTGTTTCAGGTGGAT 0: 1
1: 0
2: 2
3: 5
4: 239
Right 1137348584 16:47689063-47689085 TATGAACTTCAGATCCGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1137348579_1137348584 14 Left 1137348579 16:47689026-47689048 CCTGTTTTGTTTCAGGTGGATCA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1137348584 16:47689063-47689085 TATGAACTTCAGATCCGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
1137348578_1137348584 15 Left 1137348578 16:47689025-47689047 CCCTGTTTTGTTTCAGGTGGATC 0: 1
1: 0
2: 1
3: 11
4: 144
Right 1137348584 16:47689063-47689085 TATGAACTTCAGATCCGTGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137348584 Original CRISPR TATGAACTTCAGATCCGTGG CGG Exonic