ID: 1137351618

View in Genome Browser
Species Human (GRCh38)
Location 16:47718474-47718496
Sequence TGAACCCCATGAACCAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137351616_1137351618 4 Left 1137351616 16:47718447-47718469 CCCGCACAGCTCAGGCTTGAGGC No data
Right 1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG No data
1137351612_1137351618 7 Left 1137351612 16:47718444-47718466 CCCCCCGCACAGCTCAGGCTTGA No data
Right 1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG No data
1137351614_1137351618 5 Left 1137351614 16:47718446-47718468 CCCCGCACAGCTCAGGCTTGAGG No data
Right 1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG No data
1137351617_1137351618 3 Left 1137351617 16:47718448-47718470 CCGCACAGCTCAGGCTTGAGGCT No data
Right 1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG No data
1137351613_1137351618 6 Left 1137351613 16:47718445-47718467 CCCCCGCACAGCTCAGGCTTGAG No data
Right 1137351618 16:47718474-47718496 TGAACCCCATGAACCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137351618 Original CRISPR TGAACCCCATGAACCAGAAG TGG Intergenic
No off target data available for this crispr