ID: 1137353126

View in Genome Browser
Species Human (GRCh38)
Location 16:47731944-47731966
Sequence TGGCCACATTTTCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137353120_1137353126 29 Left 1137353120 16:47731892-47731914 CCCAGGGTTCAACCTTGGTTATT No data
Right 1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG No data
1137353122_1137353126 17 Left 1137353122 16:47731904-47731926 CCTTGGTTATTTTGCTGTTGTTA No data
Right 1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG No data
1137353121_1137353126 28 Left 1137353121 16:47731893-47731915 CCAGGGTTCAACCTTGGTTATTT No data
Right 1137353126 16:47731944-47731966 TGGCCACATTTTCAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137353126 Original CRISPR TGGCCACATTTTCAAAGAAC TGG Intergenic
No off target data available for this crispr