ID: 1137356617

View in Genome Browser
Species Human (GRCh38)
Location 16:47772321-47772343
Sequence CATTTAAGGCAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137356617_1137356624 19 Left 1137356617 16:47772321-47772343 CCCTCTACCCTCTGCCTTAAATG No data
Right 1137356624 16:47772363-47772385 CACTGTGTCTTTGTTCTCATTGG 0: 18
1: 675
2: 1256
3: 3621
4: 5082

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137356617 Original CRISPR CATTTAAGGCAGAGGGTAGA GGG (reversed) Intergenic
No off target data available for this crispr