ID: 1137359315

View in Genome Browser
Species Human (GRCh38)
Location 16:47798283-47798305
Sequence TAGCAGATGCACACCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137359315_1137359317 10 Left 1137359315 16:47798283-47798305 CCTTCCTGGGTGTGCATCTGCTA No data
Right 1137359317 16:47798316-47798338 GCTATTCCTTTGCTGTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137359315 Original CRISPR TAGCAGATGCACACCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr