ID: 1137365138

View in Genome Browser
Species Human (GRCh38)
Location 16:47853602-47853624
Sequence GCTTTTATGCAGAGGTAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137365136_1137365138 -7 Left 1137365136 16:47853586-47853608 CCTTGTGAAAACTTCGGCTTTTA No data
Right 1137365138 16:47853602-47853624 GCTTTTATGCAGAGGTAAACAGG No data
1137365134_1137365138 8 Left 1137365134 16:47853571-47853593 CCGGGTCACTCAGGGCCTTGTGA No data
Right 1137365138 16:47853602-47853624 GCTTTTATGCAGAGGTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137365138 Original CRISPR GCTTTTATGCAGAGGTAAAC AGG Intergenic
No off target data available for this crispr