ID: 1137365394

View in Genome Browser
Species Human (GRCh38)
Location 16:47855543-47855565
Sequence CCAGTAAGGTACACGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137365394_1137365398 -10 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365398 16:47855556-47855578 ACCTTACTGGCCCCAGCCCAAGG No data
1137365394_1137365407 10 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365407 16:47855576-47855598 AGGAGGGCAACACAGAACTCTGG No data
1137365394_1137365408 11 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365408 16:47855577-47855599 GGAGGGCAACACAGAACTCTGGG No data
1137365394_1137365400 -7 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365400 16:47855559-47855581 TTACTGGCCCCAGCCCAAGGAGG No data
1137365394_1137365411 29 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365411 16:47855595-47855617 CTGGGACCCAGAATCAGCTGGGG No data
1137365394_1137365409 27 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365409 16:47855593-47855615 CTCTGGGACCCAGAATCAGCTGG No data
1137365394_1137365410 28 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365410 16:47855594-47855616 TCTGGGACCCAGAATCAGCTGGG No data
1137365394_1137365401 -6 Left 1137365394 16:47855543-47855565 CCTCCCTTCGTGTACCTTACTGG No data
Right 1137365401 16:47855560-47855582 TACTGGCCCCAGCCCAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137365394 Original CRISPR CCAGTAAGGTACACGAAGGG AGG (reversed) Intergenic
No off target data available for this crispr