ID: 1137365478

View in Genome Browser
Species Human (GRCh38)
Location 16:47855895-47855917
Sequence GTGTGTGTGCGCGTGTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137365474_1137365478 8 Left 1137365474 16:47855864-47855886 CCATGAGCTTCTGTGTGTGTTGG No data
Right 1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG No data
1137365473_1137365478 9 Left 1137365473 16:47855863-47855885 CCCATGAGCTTCTGTGTGTGTTG No data
Right 1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG No data
1137365472_1137365478 17 Left 1137365472 16:47855855-47855877 CCTCTGGACCCATGAGCTTCTGT No data
Right 1137365478 16:47855895-47855917 GTGTGTGTGCGCGTGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137365478 Original CRISPR GTGTGTGTGCGCGTGTTCAG AGG Intergenic
No off target data available for this crispr