ID: 1137367123

View in Genome Browser
Species Human (GRCh38)
Location 16:47870316-47870338
Sequence GGTGGTACTCAGCAGTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137367123_1137367128 -2 Left 1137367123 16:47870316-47870338 CCACTCCACTGCTGAGTACCACC No data
Right 1137367128 16:47870337-47870359 CCTCTGAGTGTCAGGCTTTATGG No data
1137367123_1137367132 29 Left 1137367123 16:47870316-47870338 CCACTCCACTGCTGAGTACCACC No data
Right 1137367132 16:47870368-47870390 TAGTTGCTTGTCTTCCCACTAGG No data
1137367123_1137367129 4 Left 1137367123 16:47870316-47870338 CCACTCCACTGCTGAGTACCACC No data
Right 1137367129 16:47870343-47870365 AGTGTCAGGCTTTATGGCCTTGG No data
1137367123_1137367125 -10 Left 1137367123 16:47870316-47870338 CCACTCCACTGCTGAGTACCACC No data
Right 1137367125 16:47870329-47870351 GAGTACCACCTCTGAGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137367123 Original CRISPR GGTGGTACTCAGCAGTGGAG TGG (reversed) Intergenic
No off target data available for this crispr