ID: 1137372870

View in Genome Browser
Species Human (GRCh38)
Location 16:47924918-47924940
Sequence TTGTATAAGCAGAGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137372864_1137372870 -7 Left 1137372864 16:47924902-47924924 CCCCCAGAGCTTTGCCTTGTATA No data
Right 1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG No data
1137372867_1137372870 -10 Left 1137372867 16:47924905-47924927 CCAGAGCTTTGCCTTGTATAAGC No data
Right 1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG No data
1137372865_1137372870 -8 Left 1137372865 16:47924903-47924925 CCCCAGAGCTTTGCCTTGTATAA No data
Right 1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG No data
1137372866_1137372870 -9 Left 1137372866 16:47924904-47924926 CCCAGAGCTTTGCCTTGTATAAG No data
Right 1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137372870 Original CRISPR TTGTATAAGCAGAGGCACAG TGG Intergenic
No off target data available for this crispr