ID: 1137372873

View in Genome Browser
Species Human (GRCh38)
Location 16:47924996-47925018
Sequence CATAGTAGACAGAAGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137372873_1137372876 23 Left 1137372873 16:47924996-47925018 CCTTCAGCCTTCTGTCTACTATG No data
Right 1137372876 16:47925042-47925064 AGAAGAGCAAGCTTTCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137372873 Original CRISPR CATAGTAGACAGAAGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr