ID: 1137376052

View in Genome Browser
Species Human (GRCh38)
Location 16:47952809-47952831
Sequence CCACTTATCCTTGCTGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137376052_1137376058 5 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376058 16:47952837-47952859 TACAGCCAAGCAGTAGGGTGAGG No data
1137376052_1137376061 8 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376061 16:47952840-47952862 AGCCAAGCAGTAGGGTGAGGGGG No data
1137376052_1137376057 0 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376057 16:47952832-47952854 GGATTTACAGCCAAGCAGTAGGG No data
1137376052_1137376065 15 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376065 16:47952847-47952869 CAGTAGGGTGAGGGGGTCAGGGG No data
1137376052_1137376056 -1 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376056 16:47952831-47952853 GGGATTTACAGCCAAGCAGTAGG No data
1137376052_1137376064 14 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376064 16:47952846-47952868 GCAGTAGGGTGAGGGGGTCAGGG No data
1137376052_1137376060 7 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376060 16:47952839-47952861 CAGCCAAGCAGTAGGGTGAGGGG 0: 2
1: 0
2: 1
3: 21
4: 284
1137376052_1137376063 13 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376063 16:47952845-47952867 AGCAGTAGGGTGAGGGGGTCAGG No data
1137376052_1137376059 6 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376059 16:47952838-47952860 ACAGCCAAGCAGTAGGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137376052 Original CRISPR CCACTTATCCTTGCTGTATT TGG (reversed) Intergenic
No off target data available for this crispr