ID: 1137376056

View in Genome Browser
Species Human (GRCh38)
Location 16:47952831-47952853
Sequence GGGATTTACAGCCAAGCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137376052_1137376056 -1 Left 1137376052 16:47952809-47952831 CCAAATACAGCAAGGATAAGTGG No data
Right 1137376056 16:47952831-47952853 GGGATTTACAGCCAAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137376056 Original CRISPR GGGATTTACAGCCAAGCAGT AGG Intergenic
No off target data available for this crispr