ID: 1137377098

View in Genome Browser
Species Human (GRCh38)
Location 16:47961561-47961583
Sequence AGTCATGAGCAGAAAATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137377091_1137377098 24 Left 1137377091 16:47961514-47961536 CCTTAAACTCTTTGATGGGACAC No data
Right 1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137377098 Original CRISPR AGTCATGAGCAGAAAATGGA GGG Intergenic
No off target data available for this crispr