ID: 1137392205

View in Genome Browser
Species Human (GRCh38)
Location 16:48091245-48091267
Sequence CTGCAGAACCCGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1137392205_1137392208 -10 Left 1137392205 16:48091245-48091267 CCTTCCTCCTTCGGGTTCTGCAG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1137392208 16:48091258-48091280 GGTTCTGCAGCTCCCCGTTCAGG 0: 1
1: 0
2: 0
3: 8
4: 120
1137392205_1137392209 -7 Left 1137392205 16:48091245-48091267 CCTTCCTCCTTCGGGTTCTGCAG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1137392209 16:48091261-48091283 TCTGCAGCTCCCCGTTCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1137392205 Original CRISPR CTGCAGAACCCGAAGGAGGA AGG (reversed) Intronic
900536577 1:3180717-3180739 CTGGAGACCCCTCAGGAGGAAGG - Intronic
901236446 1:7669964-7669986 CTGCAGAAAGTGGAGGAGGAGGG - Intronic
901613120 1:10515064-10515086 CTGGAGAGCCCGCTGGAGGACGG - Intronic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
904267445 1:29325890-29325912 CTGCAGGACCCTATGGAGGTGGG - Intronic
906520456 1:46464120-46464142 CTGCAGTACCCAAGGGAGGAGGG - Intergenic
906615153 1:47228847-47228869 CTGGAGCTCCCGCAGGAGGAAGG - Intronic
913002551 1:114595621-114595643 CTGCCTATCCCAAAGGAGGAAGG - Intronic
914942166 1:152032807-152032829 CTGCAGAACCAGAAGGACCCTGG - Exonic
915719503 1:157974098-157974120 CTGCACAACTGGAAGGATGAAGG - Intergenic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
918199559 1:182254518-182254540 CTGCAGAACCAGAAGAGGAAAGG + Intergenic
919298730 1:195734426-195734448 TTCCAGAACCCAAAGGATGATGG + Intergenic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
922084026 1:222328242-222328264 TTACAGAAGCCAAAGGAGGAGGG - Intergenic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
1062952635 10:1516189-1516211 CTGCAGGACACGAGGAAGGAAGG - Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1065882360 10:30047664-30047686 CTGCAGAACGGGCATGAGGATGG - Exonic
1066449064 10:35511540-35511562 CTGCAGAACCCCAGAGAGGGAGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1069984806 10:72275820-72275842 CTGCAGTACACGATGGGGGAAGG - Exonic
1072746741 10:97945261-97945283 GTGCAGAGCCCGAGGGTGGAAGG + Intronic
1075661976 10:124203930-124203952 CTGCAGAACCTTCAGGAGGATGG + Intergenic
1076590344 10:131578213-131578235 CTGCAGAACAAGAGGAAGGATGG - Intergenic
1077303237 11:1856652-1856674 CTCCAGATTCTGAAGGAGGAAGG + Intronic
1077546185 11:3171028-3171050 CTGCAGACCCCGCAGGTGGAGGG + Intergenic
1077847301 11:6039527-6039549 CTACAGAACCAGGAGAAGGAAGG - Intergenic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1083386771 11:62316807-62316829 GTGCAGAACCGAAAGGAAGATGG + Intergenic
1083990250 11:66242296-66242318 TTGCAGCACCCAAAGGAGGCGGG - Intronic
1084771192 11:71343818-71343840 CTGCAGAACCCGAGGAGGGCAGG - Intergenic
1086201006 11:84202228-84202250 CTGCAGTAACCAAAAGAGGATGG + Intronic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1088816876 11:113427374-113427396 CTGCAGGACCCTGAGGAGGGTGG - Intronic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1090746082 11:129705738-129705760 CTGCAGGACCCGAACCAGGAGGG + Intergenic
1091023340 11:132120670-132120692 TTGCAGAACCCTAAGCAGGGAGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1100308866 12:93376633-93376655 CTGCAGAGCCCAAAGTGGGAGGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1103140594 12:118544718-118544740 CTGTAGAGCCCAAAGGAGGGAGG - Intergenic
1104465568 12:128987581-128987603 CTGCAGAGGCCAAAAGAGGAAGG - Intergenic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1107332130 13:39312290-39312312 CTGCAGAACAGGAAGGGGGTGGG + Intergenic
1108346616 13:49552689-49552711 CTGCAGAACAGCAAGGAGGAAGG + Intronic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1110406915 13:75160910-75160932 CTCCAGATCCAGAAGGAGGGTGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114482849 14:23046194-23046216 TTGCAGAACACAAAGGAGGAGGG - Intergenic
1114776087 14:25483192-25483214 TTGCATAACCAGCAGGAGGAAGG + Intergenic
1115197716 14:30819568-30819590 CTGCTGATCCCAAAGGAGAAGGG - Intergenic
1116101056 14:40436872-40436894 CTGCAGAACACAAAGAAGCATGG + Intergenic
1116860743 14:49993780-49993802 CTGCAGAGCCCCAAGGGAGAAGG + Intronic
1119257077 14:73208087-73208109 CTGCAGAACCCCAAAGAGGGGGG + Intronic
1119507969 14:75189311-75189333 CCCCAGACCCTGAAGGAGGATGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119952292 14:78757599-78757621 CTGCATTTCCCAAAGGAGGATGG + Intronic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1122605951 14:102947893-102947915 CTGCAGAACACGGTGGTGGAAGG - Intronic
1122836085 14:104431784-104431806 CTGCAGCTCCAGAAGCAGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1127743089 15:61933213-61933235 CTGCAGAACCAGCAGAATGATGG + Intronic
1128519174 15:68364428-68364450 GTGCATATCCCGAAGGAGGGAGG - Intronic
1130075455 15:80685349-80685371 CAGCAGAAGCCGAAGAAGTATGG + Intronic
1131302929 15:91215349-91215371 CTGCTAAAACAGAAGGAGGAGGG - Intronic
1132687457 16:1168310-1168332 CTGCAGTTCCCAAAGCAGGAAGG + Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133912700 16:10080377-10080399 TTGCAGAAAGCGAAGGTGGAAGG + Intronic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1136273735 16:29165522-29165544 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1136685979 16:31995189-31995211 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136786591 16:32938722-32938744 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136883178 16:33915072-33915094 CTGCAGAACCAGAAGGCATAAGG + Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1142077277 16:88127267-88127289 CTTCAGAAAGTGAAGGAGGAGGG - Intergenic
1203088826 16_KI270728v1_random:1200388-1200410 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1143036779 17:4004074-4004096 CTGCGGAACCCGGAGGAGGAAGG - Intergenic
1143562160 17:7702671-7702693 CTGGAGACCCCGAGGGAGGCAGG + Intronic
1146817002 17:35950348-35950370 CTGCAGAACCCAGAACAGGAAGG - Intergenic
1147146939 17:38490854-38490876 CTGCAGAACCAGAAGGCATAAGG - Intronic
1148236367 17:45971867-45971889 CTGCAGACCCCCACTGAGGACGG + Exonic
1148359282 17:46998545-46998567 CTGCAGAACCCAGAACAGGAAGG + Intronic
1150787410 17:68174194-68174216 CTGCAGAACCCAGAACAGGAAGG - Intergenic
1152315404 17:79577745-79577767 CTGGAAAACCCAAAGGAGAAGGG + Intergenic
1152859909 17:82690370-82690392 CTGCAGAATTGGAAGGAGCATGG + Intronic
1154059738 18:11047993-11048015 CTGCAGACCATGCAGGAGGAAGG - Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1154374609 18:13798813-13798835 CCGCAGAAGCCAAGGGAGGAGGG - Intergenic
1157425093 18:47577938-47577960 CTCCAGAACACGCAGGAGTAAGG - Intergenic
1160427490 18:78788129-78788151 CTGCAGAGCCAGGAGGTGGATGG - Intergenic
1161082369 19:2317680-2317702 CTGCAGGTTCCGAAGGAGGACGG - Intronic
1161088278 19:2344900-2344922 CTGCACAACCCCGAGCAGGATGG - Intronic
1161581280 19:5082361-5082383 CTGCAGATCACGCAGGAGGCCGG + Exonic
1163567186 19:18058683-18058705 CTGCAGAACGCGAGGGAGGTGGG + Intergenic
1163672039 19:18635384-18635406 CTGGAGACCCCATAGGAGGAAGG - Intergenic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1165243558 19:34484637-34484659 CTGCAGAGCCCGGGGGAGGGGGG + Intronic
1165331854 19:35144621-35144643 CTGCAGAATCCGAAGCAGGGCGG + Intronic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1167323514 19:48810843-48810865 CTGCAGGGCGCGGAGGAGGATGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
927904239 2:26846180-26846202 CGGCAGAAACTGAAGGAGCAAGG + Intergenic
930833391 2:55769781-55769803 CTGAAGAACCCAGAGGAGGCTGG + Intergenic
932056474 2:68448513-68448535 GTGCAGGCCCCGGAGGAGGATGG + Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
934909940 2:98242599-98242621 GTGCAGAACCCGGAGAAGGACGG - Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
937490504 2:122362412-122362434 GTGCAGAACCCGAAGCCAGAAGG - Intergenic
937669966 2:124528046-124528068 CTGCAGAAAACCAAAGAGGATGG + Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941178601 2:162231973-162231995 CTGCAGAGCCAGCAGGAAGATGG - Intronic
941887192 2:170540206-170540228 CTGCAGACTCCGAAGTAGGTGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942128578 2:172853173-172853195 CTTCAGAAAATGAAGGAGGATGG - Intronic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943614103 2:190072023-190072045 CTGCAGAACTGCAAGGAGAAAGG + Intronic
946095092 2:217267650-217267672 TTTCAGAACCCGAACAAGGAAGG - Intergenic
946182394 2:217956474-217956496 CTGAAACACCCGAAGGAGCAAGG + Intronic
946855403 2:223945172-223945194 CTGCTCATCCCCAAGGAGGACGG - Exonic
948922320 2:241071553-241071575 CTGCAGAGCAGGCAGGAGGAAGG - Intronic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1175607038 20:60319502-60319524 CAACAGAACCGCAAGGAGGAAGG - Intergenic
1175821140 20:61909551-61909573 CAGCAGAACCCGGAAGAGGCAGG - Intronic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176240880 20:64075306-64075328 CTCCAGAACCTGAAGGAGTGTGG - Intronic
1177332720 21:19683136-19683158 CTACAGAGACCGAAGGAGGAGGG - Intergenic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1180172398 21:46066461-46066483 CTGCAGAACGCCACGGAGGGTGG - Intergenic
1180876217 22:19176430-19176452 TTGCAGATCCTGAAGAAGGAGGG - Exonic
1182275391 22:29185279-29185301 CTGCTGAGCCCGAGGGAGTAGGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
953361257 3:42299260-42299282 CTGCAGAACATTAAGGATGAAGG + Intergenic
953461017 3:43081241-43081263 CTGCAGATCCTGATGGAGGGCGG - Exonic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954785194 3:53087450-53087472 ATCCAGAACCTGGAGGAGGAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955636221 3:61032543-61032565 CAGCAAAACCAGAAGGAGCAGGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955946404 3:64198703-64198725 CTACAGAACTGGAATGAGGAAGG + Intronic
956712620 3:72051636-72051658 CTGAAGATCCCGATGGACGAAGG + Intergenic
961171732 3:124802061-124802083 CTGCAGGAGCCCAAGGAAGAAGG - Intronic
961347538 3:126273963-126273985 CTGCAGGACCCCAAGGGCGAGGG - Intergenic
961796224 3:129411051-129411073 CTGCAGAACCCTGGGGAGGGGGG - Intronic
962389748 3:134961254-134961276 CTGGAGAACCTGATGGAGCATGG + Intronic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966926983 3:184651036-184651058 CTGAAGAACCTCAAGCAGGATGG + Intronic
968518115 4:1023360-1023382 CTGCAGGCCCCGGGGGAGGAGGG - Intronic
968972255 4:3802185-3802207 CTGGGGCACCCCAAGGAGGATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
974615332 4:64272431-64272453 CTGCAGAACCCCAAGGGGGGCGG - Intergenic
981005068 4:139866106-139866128 CTGCAGAACCCCCAGGAGGCAGG + Intronic
984515857 4:180738337-180738359 CTGCACATCTGGAAGGAGGATGG - Intergenic
986209038 5:5652825-5652847 CAGCAGACCCCGAAGCTGGAGGG - Intergenic
986586038 5:9319602-9319624 CAGCAGCACCCCAAAGAGGAAGG + Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992588873 5:78272463-78272485 CTTCAGAATCTAAAGGAGGAGGG - Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
1001668481 5:173453718-173453740 CTGAAGAACCCCCAGCAGGACGG + Intergenic
1002159713 5:177307965-177307987 CTGCGGATCCCAAAGGAGCAAGG + Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003282961 6:4710282-4710304 CTGCAGAAAGAGAAAGAGGAAGG + Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1012550155 6:100458169-100458191 CGGCAGAAACCCAAGGAGGGCGG + Intronic
1013648463 6:112169253-112169275 CTGGAGAACCCAGAGCAGGAGGG + Intronic
1014604697 6:123458449-123458471 CTGAAGTCCCCCAAGGAGGAAGG + Intronic
1016095381 6:140030866-140030888 CTCCTGAATCCAAAGGAGGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1017871960 6:158494015-158494037 CTGCAGCACCCGGAGGGTGAGGG - Intronic
1019105002 6:169660484-169660506 CTGCTGGATCCGAAGGACGAGGG - Intronic
1019499279 7:1356238-1356260 CTGCAGATCCCGGAGGAGCCTGG - Intergenic
1019530090 7:1498967-1498989 CTGCAGAACCCCAAGGTGCGGGG - Exonic
1020951568 7:14685346-14685368 ATGCAGAACGTGAAGGATGATGG - Exonic
1021633018 7:22665226-22665248 CTGCAGCGCCCGGAGGAGGCGGG - Intergenic
1023320669 7:38994374-38994396 CTGCAGGTCCCAGAGGAGGAAGG + Intronic
1023382589 7:39623582-39623604 CTGCAGAGCCGCCAGGAGGAGGG + Exonic
1025186348 7:56862656-56862678 TTGCAGCAACCAAAGGAGGAGGG - Intergenic
1025638858 7:63349284-63349306 CTGCAGATCCTGAGGAAGGAGGG - Intergenic
1025643841 7:63398808-63398830 CTGCAGATCCTGAGGAAGGAGGG + Intergenic
1025685574 7:63714242-63714264 TTGCAGCAACCAAAGGAGGAGGG + Intergenic
1027361747 7:77416438-77416460 CTGCAGAACCGAAAGCAGCAGGG - Intergenic
1028049037 7:86159257-86159279 GTGCAGAACTGGATGGAGGATGG + Intergenic
1029910215 7:104137765-104137787 TTGGGGAGCCCGAAGGAGGATGG - Intronic
1030322949 7:108188250-108188272 CTGGAGCACCCCAAGGAGCATGG + Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031953725 7:127920394-127920416 CTGCAGAGGTCGCAGGAGGATGG + Intronic
1031994943 7:128224027-128224049 CTGCAGGGCCCAAAGCAGGATGG + Intergenic
1032919191 7:136526956-136526978 CTGCAGAGCCCCAAAGAGGGTGG + Intergenic
1033934824 7:146571658-146571680 CTGCAGAACTCGATGTAGAATGG - Intronic
1035130638 7:156650182-156650204 CGGCAGCACCGGAAGGAGGCTGG - Intronic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1041719773 8:60965396-60965418 CTGCCAAACCCGGAGAAGGAAGG - Intergenic
1044933913 8:97275999-97276021 CTGCAGAACATCAAGCAGGATGG + Exonic
1045354786 8:101375754-101375776 CTGCAGCACGTGAAGCAGGAAGG + Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1050909112 9:11044225-11044247 CTGCATAACTCTAAGGAGGGTGG - Intergenic
1055693122 9:78855671-78855693 CTGAAGAACCAGAAGTAGCAAGG + Intergenic
1056200758 9:84274080-84274102 CTGCATGACCAGAAGGTGGAAGG + Intergenic
1057090328 9:92252164-92252186 CTGTAGGACCCGAAGGCTGAAGG + Intronic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1061821943 9:133233825-133233847 CTGCAGGCCACCAAGGAGGACGG - Intergenic
1062237355 9:135516689-135516711 CTGCAGGCCACCAAGGAGGACGG + Intergenic
1185480621 X:443727-443749 GGGCAGAACCCAAGGGAGGAAGG + Intergenic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1187034285 X:15521642-15521664 CTGCAGAACCAGAAGGTTGCAGG + Intronic
1188670628 X:32877850-32877872 CTGCAGAACCAGACTGAGGCTGG + Intronic
1188803303 X:34558046-34558068 CTGCAGAACCTCAAGGAAGCAGG + Intergenic
1192716590 X:73648740-73648762 CTGGAGTACCCGAAGGAGACGGG + Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200166335 X:154038212-154038234 CTGCAGGACCCAAGGGAGGGAGG + Intronic